- Clone
- MPC-11 (See other available formats)
- Regulatory Status
- RUO
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- ATATGTATCACGCGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
400383 | 10 µg | 369 CHF |
The MPC-11 immunoglobulin has unknown specificity. This antibody was chosen as an isotype control after screening on a variety of resting, activated, live, and fixed mouse, rat and human tissues.
Product DetailsProduct Details
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: Intracellular Flow Cytometry (ICFC), Immunocytochemistry (ICC), Immunohistochemistry (IHC), Immunoprecipitation (IP), Western Blotting (WB), Functional Assay (FA).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - Product Citations
-
- RRID
-
AB_3097118 (BioLegend Cat. No. 400383)
Antigen Details
- Gene ID
- NA
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC Mouse IgG2b, κ Isotype Ctrl
-
Biotin Mouse IgG2b, κ Isotype Ctrl
-
FITC Mouse IgG2b, κ Isotype Ctrl
-
PE Mouse IgG2b, κ Isotype Ctrl
-
PE/Cyanine5 Mouse IgG2b, κ Isotype Ctrl
-
Purified Mouse IgG2b, κ Isotype Ctrl
Chromatin Immunoprecipitations (ChIP) were performed with cr... Chromatin Immunoprecipitations (ChIP) were performed with cr... -
APC/Cyanine7 Mouse IgG2b, κ Isotype Ctrl
-
PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 647 Mouse IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 488 Mouse IgG2b, κ Isotype Ctrl
-
Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 700 Mouse IgG2b, κ Isotype Ctrl
-
PerCP Mouse IgG2b, κ Isotype Ctrl
Human peripheral blood lymphocytes stained with MPC-11 PerCP -
PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl
Human peripheral blood lymphocytes stained with MPC-11 PerCP... -
Brilliant Violet 421™ Mouse IgG2b, κ Isotype Ctrl
-
Brilliant Violet 570™ Mouse IgG2b, κ Isotype Ctrl
-
Brilliant Violet 510™ Mouse IgG2b, κ Isotype Ctrl
-
Ultra-LEAF™ Purified Mouse IgG2b, κ Isotype Ctrl
-
Brilliant Violet 605™ Mouse IgG2b, κ Isotype Ctrl
-
Brilliant Violet 650™ Mouse IgG2b, κ Isotype Ctrl
-
Brilliant Violet 711™ Mouse IgG2b, κ Isotype Ctrl
-
Brilliant Violet 785™ Mouse IgG2b, κ Isotype Ctrl
-
PE/Dazzle™ 594 Mouse IgG2b, κ Isotype Ctrl
-
Alexa Fluor® 594 Mouse IgG2b, κ Isotype Ctrl
-
APC/Fire™ 750 Mouse IgG2b, κ Isotype Ctrl
-
GoInVivo™ Purified Mouse IgG2b, κ Isotype Ctrl
-
FITC Mouse IgG2b, κ Isotype Ctrl
-
Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl
-
APC Mouse IgG2b, κ Isotype Ctrl
-
TotalSeq™-A0092 Mouse IgG2b, κ isotype Ctrl
-
PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl
-
TotalSeq™-B0092 Mouse IgG2b, κ isotype Ctrl
-
TotalSeq™-C0092 Mouse IgG2b, κ isotype Ctrl
-
PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl
-
TotalSeq™-D0092 Mouse IgG2b, κ Isotype Ctrl
-
GMP APC Mouse IgG2b, κ Isotype Ctrl
-
GMP FITC Mouse IgG2b, κ Isotype Ctrl
-
GMP Pacific Blue™ Mouse IgG2b, κ Isotype Ctrl
-
GMP PerCP/Cyanine5.5 Mouse IgG2b, κ Isotype Ctrl
-
Brilliant Violet 750™ Mouse IgG2b, κ Isotype Ctrl
-
Spark NIR 685™ Mouse IgG2b, κ Isotype Ctrl
-
PE/Fire™ 810 Mouse IgG2b, κ Isotype Ctrl
-
TotalSeq™-Bn0092 Mouse IgG2b, κ Isotype Ctrl
-
PE/Fire™ 700 Mouse IgG2b, κ Isotype Ctrl
-
KIRAVIA Blue 520™ Mouse IgG2b, κ Isotype Ctrl
-
PE/Fire™ 640 Mouse IgG2b, κ Isotype Ctrl
-
GMP PE/Cyanine7 Mouse IgG2b, κ Isotype Ctrl
-
APC/Fire™ 810 Mouse IgG2b, κ Isotype Ctrl
-
Spark YG™ 570 Mouse IgG2b, κ Isotype Ctrl
-
PerCP/Fire™ 806 Mouse IgG2b, κ Isotype Ctrl
-
Spark Red™ 718 Mouse IgG2b, κ Isotype Ctrl
-
Spark Blue™ 515 Mouse IgG2b, κ Isotype Ctrl
-
PerCP/Fire™ 780 Mouse IgG2b, κ Isotype Ctrl
-
PE/Fire™ 744 Mouse IgG2b, κ Isotype Ctrl
-
Spark PLUS UV395™ Mouse IgG2b, κ Isotype Ctrl
-
TotalSeq™-B1473 Mouse IgG2b, κ Isotype Ctrl
Follow Us