- Clone
- NC-08 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- T1a, T1a2, gp36, gp38, gp40, Aggrus, PDPN, D2-40
- Isotype
- Rat IgG2a, λ
- Barcode Sequence
- GGTTACTCGTTGTGT
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
337035 | 10 µg | 369 CHF |
Podoplanin is a 40-43 kD type-I transmembrane sialomucin-type glycoprotein, also known as T1a, gp36, gp38, gp40, and Aggrus. Originally detected on the surface of podocytes, futher characterization showed podoplanin has a broad tissue distribution, including mesothelial cells, epithelial cells, follicular dendritic cells, and a variety of tumor cells. It has been reported that podoplanin is the ligand of CLEC2 and is involved in lymphatic vessel formation, platelet aggregation, and tumor metastasis. Podoplanin may serve as a useful marker for tumor diagnosis and prognosis.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunofluorescence1.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Fujino N, et al. 2012. Am. J. Respir. Cell. Mol. Biol. 46:422. (FC, IF)
- RRID
-
AB_2941513 (BioLegend Cat. No. 337035)
Antigen Details
- Structure
- 40-43 kD type-I transmembrane sialomucin-type glycoprotein
- Distribution
-
Broad tissue distribution, including mesothelial cells, epithelial cells, follicular dendritic cells, and many tumor cells
- Function
- Lymphatic vessel formation, tumor metastasis, platelet aggregation
- Ligand/Receptor
- CLEC2
- Cell Type
- Dendritic cells
- Biology Area
- Cancer Biomarkers, Cell Biology, Immunology, Neuroinflammation, Neuroscience, Neuroscience Cell Markers
- Antigen References
-
1. Raica M, et al. 2008. Anticancer Res. 28:2997.
2. Xie Q, et al. 2008. Int. J. Clin. Exp. Pathol. 1:276.
3. Ogasawara S, et al. 2008. Hybridoma. 27:259.
4. Kato Y, et al. 2003. J. Bio. Chem. 278:51599. - Gene ID
- 10630 View all products for this Gene ID
- UniProt
- View information about Podoplanin on UniProt.org
Related FAQs
Other Formats
View All Podoplanin Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human Podoplanin | NC-08 | FC,IHC-P,ICC,SB |
PE anti-human Podoplanin | NC-08 | FC |
Alexa Fluor® 647 anti-human Podoplanin | NC-08 | FC |
Alexa Fluor® 488 anti-human Podoplanin | NC-08 | FC |
PE/Cyanine7 anti-human Podoplanin | NC-08 | FC |
Biotin anti-human Podoplanin | NC-08 | FC |
PerCP/Cyanine5.5 anti-human Podoplanin | NC-08 | FC |
Alexa Fluor® 594 anti-human Podoplanin | NC-08 | ICC |
TotalSeq™-A0127 anti-human Podoplanin | NC-08 | PG |
APC/Cyanine7 anti-human Podoplanin | NC-08 | FC |
APC/Fire™ 750 anti-human Podoplanin | NC-08 | FC |
FITC anti-human Podoplanin | NC-08 | FC |
APC anti-human Podoplanin | NC-08 | FC |
PE/Dazzle™ 594 anti-human Podoplanin | NC-08 | FC |
TotalSeq™-C0127 anti-human Podoplanin | NC-08 | PG |
TotalSeq™-B0127 anti-human Podoplanin | NC-08 | PG |
TotalSeq™-D0127 anti-human Podoplanin | NC-08 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human Podoplanin
SeqIF™ (sequential immunofluorescence) staining on COMET™ of... IHC staining of Purified anti-human Podoplanin (clone NC-08)... IHC staining of Purified anti-human Podoplanin (clone NC-08)... -
PE anti-human Podoplanin
Human glioblastoma cell line LN319 stained with NC-08 PE -
Alexa Fluor® 647 anti-human Podoplanin
Human glioblastoma cell line LN319 stained with NC-08 Alexa ... -
Alexa Fluor® 488 anti-human Podoplanin
Human glioblastoma cell line LN 319 stained with NC-08 Alexa... -
PE/Cyanine7 anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with podoplan... -
Biotin anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with biotinyl... -
PerCP/Cyanine5.5 anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with podoplan... -
Alexa Fluor® 594 anti-human Podoplanin
Human glioblastoma cell line, LN319 were fixed with 1% paraf... -
TotalSeq™-A0127 anti-human Podoplanin
-
APC/Cyanine7 anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with podoplan... -
APC/Fire™ 750 anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with podoplan... -
FITC anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with podoplan... -
APC anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with podoplan... -
PE/Dazzle™ 594 anti-human Podoplanin
Human glioblastoma cell line LN319 was stained with podoplan... -
TotalSeq™-C0127 anti-human Podoplanin
-
TotalSeq™-B0127 anti-human Podoplanin
-
TotalSeq™-D0127 anti-human Podoplanin
Follow Us