- Clone
- FN50 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- IV A91
- Other Names
- Very Early Activation Antigen (VEA), Activation inducer molecule (AIM)
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GTCTCTTGGCTTAAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
310963 | 10 µg | 369 CHF |
CD69 is a 27-33 kD type II transmembrane protein also known as activation inducer molecule (AIM), very early activation antigen (VEA), and MLR3. It is a member of the C-type lectin family, expressed as a disulfide-linked homodimer. Other members of this receptor family include NKG2, NKR-P1 CD94, and Ly49. CD69 is transiently expressed on activated leukocytes including T cells, thymocytes, B cells, NK cells, neutrophils, and eosinophils. CD69 is constitutively expressed by a subset of medullary mature thymocytes, platelets, mantle B cells, and certain CD4+ T cells in germinal centers of normal lymph nodes. CD69 is involved in early events of lymphocyte, monocyte, and platelet activation, and has a functional role in redirected lysis mediated by activated NK cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Chimpanzee, Cynomolgus, Pigtailed Macaque, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections2, immunofluorescence microscopy3, and spatial biology (IBEX)8,9.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Knapp WB, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
- Sakkas LI, et al. 1998. Clin. and Diag. Lab. Immunol. 5:430. (IHC)
- Kim JR, et al. 2005. BMC Immunol. 6:3. (IF)
- Verjans GM, et al. 2007. P. Natl. Acad. Sci. USA 104:3496.
- Lu H, et al. 2009. Toxicol Sci. 112:363. (FC) PubMed
- Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2892376 (BioLegend Cat. No. 310963)
Antigen Details
- Structure
- C-type lectin, type II glycoprotein, 28/32 kD
- Distribution
-
Activated T cells, B cells, NK cells, granulocytes, thymocytes, platelets, Langerhans cells
- Function
- Lymphocyte, monocyte, and platelet activation, NK cell killing
- Cell Type
- B cells, Granulocytes, Langerhans cells, NK cells, Platelets, T cells, Thymocytes, Tregs
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
2. Testi R, et al. 1994. Immunol. Today 15:479. - Gene ID
- 969 View all products for this Gene ID
- UniProt
- View information about CD69 on UniProt.org
Related FAQs
Other Formats
View All CD69 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD69
PHA-activated human peripheral blood lymphocytes stained wit... -
FITC anti-human CD69
PMA + ionomycin stimulated (6 hours) human lymphocytes stain... -
PE anti-human CD69
PMA + ionomycin stimulated (6 hours) human lymphocytes stain... -
PE/Cyanine5 anti-human CD69
PHA-activated human peripheral blood lymphocytes stained wit... -
APC anti-human CD69
PMA+ionomycin-stimulated (5hours) human peripheral blood lym... -
APC/Cyanine7 anti-human CD69
PMA + Ionomycin stimulated (6 hours) human peripheral blood ... -
PE/Cyanine7 anti-human CD69
PMA+ionomycin activated human peripheral blood lymphocytes s... -
Alexa Fluor® 488 anti-human CD69
PMA+ionomycin activated human peripheral blood lymphocytes s... -
Alexa Fluor® 647 anti-human CD69
PMA+ionomycin activated human peripheral blood lymphocytes s... Confocal image of human lymph node sample acquired using the... Confocal image of human liver sample acquired using the IBEX... -
Pacific Blue™ anti-human CD69
PMA+ionomycin-stimulated human peripheral blood mononuclear ... -
Alexa Fluor® 700 anti-human CD69
PMA + Ionomycin-stimulated (5 hours) human peripheral blood ... -
Biotin anti-human CD69
PHA-stimulated human peripheral blood mononuclear cells (day... -
PerCP/Cyanine5.5 anti-human CD69
PMA+ ionomycin stimulated (6 hours) human peripheral blood l... -
PerCP anti-human CD69
PMA + Inonomycin-stimulated (5 hours) human peripheral blood... -
Brilliant Violet 421™ anti-human CD69
Human peripheral blood lymphocytes were stimulated with PMA ... -
Brilliant Violet 785™ anti-human CD69
Human peripheral blood lymphocytes were stimulated with PMA ... -
Brilliant Violet 650™ anti-human CD69
PMA + ionomycin-stimulated (6 hours) human peripheral blood ... -
Brilliant Violet 510™ anti-human CD69
Human peripheral blood lymphocytes were stimulated with PMA+... -
Brilliant Violet 605™ anti-human CD69
PMA+ ionomycin-stimulated (6 hours) human periphe... -
Purified anti-human CD69 (Maxpar® Ready)
Human PBMCs were incubated for 6 hours in media alone (botto... -
PE/Dazzle™ 594 anti-human CD69
PMA + ionomycin-stimulated (6 hours) human peripheral blood ... -
Brilliant Violet 711™ anti-human CD69
PMA + ionomycin-stimulated (six hours) human peripheral bloo... -
APC/Fire™ 750 anti-human CD69
Human peripheral blood lymphocytes were stimulated with PMA ... -
TotalSeq™-A0146 anti-human CD69
-
TotalSeq™-B0146 anti-human CD69
-
TotalSeq™-C0146 anti-human CD69
-
Brilliant Violet 750™ anti-human CD69
PMA+ ionomycin stimulated (6 hours) human peripheral blood l... -
KIRAVIA Blue 520™ anti-human CD69
PMA + ionomycin stimulated human peripheral blood lymphocyte... -
Spark NIR™ 685 anti-human CD69 Antibody
Human peripheral blood lymphocytes were stimulated with PMA+... -
PE/Fire™ 640 anti-human CD69
PMA+ionomycin activated human peripheral blood lymphocytes w... -
Spark YG™ 581 anti-human CD69
PMA+ionomycin activated human peripheral blood lymphocytes w... -
TotalSeq™-D0146 anti-human CD69
-
APC anti-human CD69
Typical results from Cell Activation Cocktail (without Brefe... -
Spark Blue™ 550 anti-human CD69
Human peripheral blood lymphocytes were stimulated with PMA... -
PE anti-human CD69
Typical results from Cell Activation Cocktail (without Brefe... -
Spark Red™ 718 anti-human CD69
PMA+ ionomycin stimulated (6 hours) human peripheral blood l... -
GMP PE anti-human CD69
Typical results from Cell Activation Cocktail (without Brefe... -
PE/Fire™ 810 anti-human CD69
PMA+ ionomycin stimulated (6 hours) human peripheral blood l... -
PE/Fire™ 744 anti-human CD69
Human peripheral blood lymphocytes were stained with anti-hu... PMA+ionomycin activated human peripheral blood lymphocytes w... -
Spark PLUS UV395™ anti-human CD69
Human peripheral blood lymphocytes were stimulated with PMA/... -
Spark Blue™ 574 anti-human CD69 (Flexi-Fluor™)
Follow Us