- Clone
- MIH26 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- BTLA, B and T lymphocyte attenuator
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- GTTATTGGACTAAGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
344535 | 10 µg | 369 CHF |
B and T lymphocyte attenuator (BTLA) is an Ig superfamily coinhibitory receptor with structural similarity to programmed cell death 1 (PD-1) and CTLA-4. BTLA is expressed on B cells, T cells, macrophages, dendritic cells, NKT cells, and NK cells. Engagement of BTLA by its ligand Herpes Virus Entry Mediator (HVEM) is critical for negatively regulating immune response. The absence of BTLA with HVEM inhibitory interactions leads to increased experimental autoimmune encephalomyelitis severity, enhanced rejection of partially mismatched allografts, an increased CD8+ memory T cell population, increased severity of colitis, and reduced effectiveness of T regulatory cells. BTLA plays an important role in the induction of peripheral tolerance of both CD4+ and CD8+ T cells in vivo. Tolerant T cells have significant up-regulated expression of BTLA compared with effector and naïve T cells. BTLA may cooperate with CTLA-4 and PD-1 to control T cell tolerance and autoimmunity. It has been reported that BTLA may regulate T cell function through binding to B7-H4.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human BTLA transfected cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: inhibition of T cell proliferation and cytokine production1. Clone MIH26 has agonistic activity on BTLA, resulting in the inhibition of activation.
The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for use in in vitro and in vivo biofunctional assays. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Otsuki N, et al. 2006. Biochem. Bioph. Res. Co. 344:1121.
- Okano M, et al. 2008. Clin. Exp. Allergy 38:1891.
- RRID
-
AB_2894681 (BioLegend Cat. No. 344535)
Antigen Details
- Structure
- Ig superfamily, with similar structure to CTLA-4 and PD-1
- Distribution
-
B cells and T lymphocytes, NK cells and dendritic cells
- Function
- Negative regulation of T cell activation, proliferation and cytokine production
- Ligand/Receptor
- HVEM
- Cell Type
- B cells, Dendritic cells, NK cells, T cells, Tregs
- Biology Area
- Immunology, Inhibitory Molecules
- Molecular Family
- CD Molecules
- Antigen References
-
1. Watanabe N, et al. 2003. Nat. Immunol. 4:670.
2. Sun Y, et al. 2009. J. Immunol. 183:1946.
3. Gonzalez LC, et al. 2005. P. Natl. Acad. Sci. USA 102:1116. - Gene ID
- 151888 View all products for this Gene ID
- UniProt
- View information about CD272 on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All CD272 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD272 (BTLA) | MIH26 | FC,Agonist |
PE anti-human CD272 (BTLA) | MIH26 | FC |
APC anti-human CD272 (BTLA) | MIH26 | FC |
Brilliant Violet 421™ anti-human CD272 (BTLA) | MIH26 | FC |
PerCP/Cyanine5.5 anti-human CD272 (BTLA) | MIH26 | FC |
APC/Cyanine7 anti-human CD272 (BTLA) | MIH26 | FC |
PE/Cyanine7 anti-human CD272 (BTLA) | MIH26 | FC |
Alexa Fluor® 647 anti-human CD272 (BTLA) | MIH26 | FC |
PE/Dazzle™ 594 anti-human CD272 (BTLA) | MIH26 | FC |
FITC anti-human CD272 (BTLA) | MIH26 | FC |
TotalSeq™-A0170 anti-human CD272 (BTLA) | MIH26 | PG |
TotalSeq™-C0170 anti-human CD272 (BTLA) | MIH26 | PG |
Ultra-LEAF™ Purified anti-human CD272 (BTLA) | MIH26 | FC,Agonist |
PE/Cyanine5 anti-human CD272 (BTLA) | MIH26 | FC |
TotalSeq™-B0170 anti-human CD272 (BTLA) | MIH26 | PG |
TotalSeq™-D0170 anti-human CD272 (BTLA) | MIH26 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD272 (BTLA)
-
PE anti-human CD272 (BTLA)
-
APC anti-human CD272 (BTLA)
-
Brilliant Violet 421™ anti-human CD272 (BTLA)
-
PerCP/Cyanine5.5 anti-human CD272 (BTLA)
-
APC/Cyanine7 anti-human CD272 (BTLA)
-
PE/Cyanine7 anti-human CD272 (BTLA)
-
Alexa Fluor® 647 anti-human CD272 (BTLA)
-
PE/Dazzle™ 594 anti-human CD272 (BTLA)
-
FITC anti-human CD272 (BTLA)
-
TotalSeq™-A0170 anti-human CD272 (BTLA)
-
TotalSeq™-C0170 anti-human CD272 (BTLA)
-
Ultra-LEAF™ Purified anti-human CD272 (BTLA)
-
PE/Cyanine5 anti-human CD272 (BTLA)
-
TotalSeq™-B0170 anti-human CD272 (BTLA)
-
TotalSeq™-D0170 anti-human CD272 (BTLA)
Follow Us