- Clone
- C398.4A (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Inducible COStimulatory molecule, H4
- Isotype
- Armenian Hamster IgG
- Barcode Sequence
- CGCGCACCCATTAAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
313561 | 10 µg | 369 CHF |
ICOS, also known as inducible costimulatory molecule and H4, is a 47-57 kD protein. This protein is homologous to the CD28/CTLA-4 proteins. ICOS is expressed on activated T cells and a subset of thymocytes. It is able to costimulate T cells proliferation. In addition, ICOS is involved in humoral immune responses (B cell germinal center formation). The ICOS ligand is B7h/B7RP-1 or B7-H2. ICOS stimulation has been shown to potentiate TCR-mediated IL-4 and IL-10 production and has been proposed to play a role in Th2 cell development.
Product DetailsProduct Details
- Verified Reactivity
- Human, Mouse, Rat
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus, Pig
- Antibody Type
- Monoclonal
- Host Species
- Armenian Hamster
- Immunogen
- Mouse T cell clone D10.G4.1
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
- The C398.4A antibody is useful for flow cytometric analysis and is able to costimulate T cell activation and proliferation. Additional reported applications (for the relevant formats) include: immunoprecipitation1, in vitro costimulation of T cell activation1,3,4, and spatial biology (IBEX)5,6. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 313512).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Redoglia V, et al. 1996. Eur. J. Immunol. 26:2781. (FC IP Costim)
- Yagi J, et al. 2003. J. Immunol. 171:783. (FC)
- Arimura Y, et al. 2002. Int. Immunol. 14:555. (Costim)
- Arimura Y, et al. 2004. J. Biol. Chem. 279:11408. (Costim)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2894687 (BioLegend Cat. No. 313561)
Antigen Details
- Structure
- CD28/CTLA-4, 47-57 kD
- Distribution
-
Activated T cells, subset of thymocytes
- Function
- Costimulates T cell activation, proliferation, humoral immune response
- Ligand/Receptor
- B7h/B7RP-1/GL-50
- Cell Type
- T cells, Thymocytes, Tregs
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Redoglia V, et al. 1996. Eur. J. Immunol. 26:2781.
2. Hutloff A, et al. 1999. Nature 397:263.
3. Buonfiglio D, et al. 2000. Eur. J. Immunol. 30:3463.
4. Coyle AJ, et al. 2000. Immunity 13:95. - Gene ID
- 100048841 View all products for this Gene ID 29851 View all products for this Gene ID 64545 View all products for this Gene ID
- UniProt
- View information about CD278 on UniProt.org
Other Formats
View All CD278 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... SeqIF™ (sequential immunofluorescence) staining on COMET™ of... -
Biotin anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
FITC anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
PE anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
APC anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
Alexa Fluor® 488 anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... Confocal image of human lymph node sample acquired using the... -
Alexa Fluor® 647 anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... Frozen mouse lymph node section detected with anti-ICOS Alex... -
PerCP/Cyanine5.5 anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated (three days) human peripheral blood lymphocyt... -
PE/Cyanine7 anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
Pacific Blue™ anti-human/mouse/rat CD278 (ICOS)
PHA-activated (3 days) human peripheral blood lymphocytes we... -
Brilliant Violet 421™ anti-human/mouse/rat CD278 (ICOS)
PHA-activated (3 days) human peripheral blood lymphocytes we... -
Brilliant Violet 510™ anti-human/mouse/rat CD278 (ICOS)
PHA-activated (3 days) human peripheral blood lymphocytes we... -
APC/Cyanine7 anti-human/mouse/rat CD278 (ICOS)
PHA-activated (three days) human peripheral blood lymphocyte... -
PE/Dazzle™ 594 anti-human/mouse/rat CD278 (ICOS)
PHA-activated (three days) human peripheral blood lymphocyte... -
Alexa Fluor® 700 anti-human/mouse/rat CD278 (ICOS)
PHA-activated (three days) human peripheral blood lymphocyte... -
APC/Fire™ 750 anti-human/mouse/rat CD278 (ICOS)
PHA-activated (three days) human peripheral blood lymphocyte... -
Brilliant Violet 785™ anti-human/mouse/rat CD278 (ICOS)
PHA-activated (three days) human peripheral blood lymphocyte... -
Brilliant Violet 605™ anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
Ultra-LEAF™ Purified anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) w... -
GoInVivo™ Purified anti-human/mouse/rat CD278 (ICOS)
-
Brilliant Violet 711™ anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
Brilliant Violet 650™ anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated human peripheral blood lymphocytes (3 days) s... -
TotalSeq™-B0171 anti-human/mouse/rat CD278 (ICOS)
-
TotalSeq™-C0171 anti-human/mouse/rat CD278 (ICOS)
-
TotalSeq™-A0171 anti-human/mouse/rat CD278 (ICOS)
-
Brilliant Violet 750™ anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated (3 days) human peripheral blood lymphocytes w... -
TotalSeq™-D0171 anti-human/mouse/rat CD278 (ICOS) Antibody
-
PE/Cyanine5 anti-human/mouse/rat CD278 (ICOS)
PHA stimulated human peripheral blood lymphocytes (3 days) w... -
Spark Red™ 718 anti-human/mouse/rat CD278 (ICOS)
PHA-stimulated (three days) human peripheral blood lymphocyt... -
Spark PLUS UV395™ anti-human/mouse/rat CD278 (ICOS)
Human peripheral blood lymphocytes were stained with anti-hu... PHA-stimulated human peripheral blood lymphocytes (3 days) w...
Follow Us