- Clone
- HIP1 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- IV P70
- Other Names
- Glycocalicin, gpIbα
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TCCTAGTACCGAAGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
303945 | 10 µg | 369 CHF |
CD42b is a 145 kD glycoprotein known as gpIbα. It is covalently bonded to CD42c to form GPIb. CD42b is expressed on platelets and megakaryocytes. CD42b/c heterodimer forms a complex with CD42a and d and acts as the receptor for von Willibrand factor and thrombin.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone HIP1 recognizes an epitope within the N-terminal region of the GPIba chain5. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, Westerm blotting, and inhibition of platelet aggregation2. The Ultra LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 303939).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2904333 (BioLegend Cat. No. 303945)
Antigen Details
- Structure
- Mucin, leucine-rich repeat family, 145 kD
- Distribution
-
Platelets, megakaryocytes
- Function
- Complex with CD42a, c and d, platelet adhesion and activation
- Ligand/Receptor
- Von Willebrand factor, thrombin
- Cell Type
- Megakaryocytes, Platelets
- Biology Area
- Cell Adhesion, Cell Biology, Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Clemetson K, et al. 1982. J. Clin. Invest. 70:304.
2. Fox J, et al. 1988. J. Biol. Chem. 263:4882.
3. Kuijpers R, et al. 1992 Blood 79:283. - Gene ID
- 2812 View all products for this Gene ID
- UniProt
- View information about CD42b on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD42b Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-human CD42b | HIP1 | FC |
PE anti-human CD42b | HIP1 | FC |
Purified anti-human CD42b | HIP1 | FC,Block,IHC-F,WB |
PerCP anti-human CD42b | HIP1 | FC |
APC anti-human CD42b | HIP1 | FC |
APC/Cyanine7 anti-human CD42b | HIP1 | FC |
PerCP/Cyanine5.5 anti-human CD42b | HIP1 | FC |
PE/Cyanine7 anti-human CD42b | HIP1 | FC |
Alexa Fluor® 488 anti-human CD42b | HIP1 | FC |
Brilliant Violet 650™ anti-human CD42b | HIP1 | FC |
Alexa Fluor® 647 anti-human CD42b | HIP1 | FC |
Alexa Fluor® 700 anti-human CD42b | HIP1 | FC |
Brilliant Violet 510™ anti-human CD42b | HIP1 | FC |
Brilliant Violet 421™ anti-human CD42b | HIP1 | FC |
PE/Dazzle™ 594 anti-human CD42b | HIP1 | FC |
TotalSeq™-A0216 anti-human CD42b | HIP1 | PG |
Ultra-LEAF™ Purified anti-human CD42b | HIP1 | FC,Block,IHC-F,WB |
TotalSeq™-C0216 anti-human CD42b | HIP1 | PG |
TotalSeq™-B0216 anti-human CD42b | HIP1 | PG |
TotalSeq™-D0216 anti-human CD42b | HIP1 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD42b
-
PE anti-human CD42b
-
Purified anti-human CD42b
-
PerCP anti-human CD42b
-
APC anti-human CD42b
-
APC/Cyanine7 anti-human CD42b
-
PerCP/Cyanine5.5 anti-human CD42b
-
PE/Cyanine7 anti-human CD42b
-
Alexa Fluor® 488 anti-human CD42b
-
Brilliant Violet 650™ anti-human CD42b
-
Alexa Fluor® 647 anti-human CD42b
-
Alexa Fluor® 700 anti-human CD42b
-
Brilliant Violet 510™ anti-human CD42b
-
Brilliant Violet 421™ anti-human CD42b
-
PE/Dazzle™ 594 anti-human CD42b
-
TotalSeq™-A0216 anti-human CD42b
-
Ultra-LEAF™ Purified anti-human CD42b
-
TotalSeq™-C0216 anti-human CD42b
-
TotalSeq™-B0216 anti-human CD42b
-
TotalSeq™-D0216 anti-human CD42b
Follow Us