Loading...

TotalSeq™-D0360 anti-human CD357 (GITR) Antibody

Pricing & Availability
Clone
108-17 (See other available formats)
Regulatory Status
RUO
Other Names
TNFRSF18, Activation-inducible TNFR, AITR, Glucocorticoid-inducible TNFR
Isotype
Mouse IgG2a, κ
Barcode Sequence
ACCTTTCGACACTCG
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
371233 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

GITR (glucocorticoid-induced TNF receptor family-regulated gene) is a 25 kD TNF receptor superfamily member (also known as AITR and TNFRSF18). GITR is expressed on activated lymphocytes and is upregulated by T cell receptor engagement. The cytoplasmic domain of GITR is homologous to CD40, 4-1BB and CD27 and has been shown to interact with TRAF 1-3, but not TRAF 5 or 6. GITR signaling has been shown to regulate T cell proliferation and TCR-mediated apoptosis, and to break immunological self-tolerance. GITR binds GITRL and is involved in the development of regulatory T cells and to regulate the activity of Th1 subsets.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant human GITR-Fc chimera
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894619 (BioLegend Cat. No. 371233)

Antigen Details

Structure
TNFR superfamily, 234-amino acid type I transmembrane protein, 25 kD.
Distribution

Activated lymphocytes.

Function
Interacts with TRAF's 1-3, but not TRAF 5 or 6, mediates NF-κB activation through the TRAF2/NIK pathway.
Ligand/Receptor
GITRL
Cell Type
Lymphocytes, Tregs
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. van der Werf N, et al. 2011. J. Immunol. 187:1411.
2. Shimizu J, et al. 2002. Nat. Immunol. 3:135.
3. McHugh RS, et al. 2002. Immunity 16:311.
4. Kwon B, et al. 1999. J. Biol. Chem. 274:6056.

Gene ID
8784 View all products for this Gene ID
UniProt
View information about CD357 on UniProt.org
Go To Top Version: 1    Revision Date: 05.26.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account