IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0577 anti-human CD73 (Ecto-5'-nucleotidase) Antibody

Pricing & Availability
Clone
AD2 (See other available formats)
Regulatory Status
RUO
Workshop
V B-CD73.3
Other Names
Ecto-5'-nucleotidase, E.C3.1.3.5, L-VAP-2, NT5E, 5'-NT
Isotype
Mouse IgG1, κ
Barcode Sequence
CAGTTCCTCAGTTCG
Ave. Rating
Submit a Review
Cat # Size Price Quantity Check Availability Save
344037 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD73 is a 70 kD glycophosphatidylinositol (GPI)-linked 5'-nucleotidase, which is also known as ecto-5'-nucleotidase. It converts adenosine monophosphate (AMP) to adenosine. CD73 is expressed on subsets of T and B cells, mesenchymal stem cells, follicular dendritic cells, endothelial cells, and epithelial cells. It has been reported that CD73 costimulates T cell activation, and mediates adhesion of lymphocytes to follicular dendritic cells and endothelial cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include:immunofluorescence3.

Clone AD2 has been noted to induce clustering and internalization of CD73 in vivo and inhibit metastasis in a murine breast cancer xenograft model4.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Nakamura T, et al. 1993. J. Immunol. 151:6933.
  2. Liao J, et al. 2011. J Endod. 37:1217. PubMed
  3. Touboul C, et al. 2013. J. Transl. Med. 11:28. (IF)
  4. Terp MG, et al. 2013. J Immunol. 191: 4165-73 (Block)
RRID
AB_2894606 (BioLegend Cat. No. 344037)

Antigen Details

Structure
GPI-linked 5'-nucleotidase, 70 kD
Distribution

Subsets of T cells and B cells, mesenchymal stem cells, follicular dendritic cells, endothelial cells, and epithelial cells

Function
Catalyses dephosphorylation of adenosine monophosphate, costimulates T cell activation, mediates adhesion of lymphocytes to follicular dendritic cells and endothelial cells
Cell Type
B cells, Dendritic cells, Endothelial cells, Epithelial cells, Mesenchymal Stem Cells, T cells, Tregs
Biology Area
Costimulatory Molecules, Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Zola H, et al. 2007. Leukocyte and stromal Cell Molecules:the CD Markers. A John Wiley & Sons Inc, Publication.
2. Airas L and Jalkanen  S, et al. 1996. Blood 88:1755.
3. Gutensohn W, et al. 1995. Cell Immunol. 161:213.
4. Airas L, et al. 1995. J. Exp. Med. 182:1603.

Gene ID
4907 View all products for this Gene ID
UniProt
View information about CD73 on UniProt.org

Other Formats

View All CD73 Reagents Request Custom Conjugation
Description Clone Applications
FITC anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Brilliant Violet 421™ anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC,IHC-F
Purified anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC,IHC-F,Block
PE anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
APC anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
PE/Cyanine7 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Pacific Blue™ anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
PerCP/Cyanine5.5 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Biotin anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
PE/Dazzle™ 594 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
APC/Cyanine7 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Brilliant Violet 605™ anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Brilliant Violet 711™ anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Brilliant Violet 785™ anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
TotalSeq™-A0577 anti-human CD73 (Ecto-5'-nucleotidase) AD2 PG
TotalSeq™-C0577 anti-human CD73 (Ecto-5'-nucleotidase) AD2 PG
TotalSeq™-B0577 anti-human CD73 (Ecto-5'-nucleotidase) AD2 PG
APC/Fire™ 750 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
TotalSeq™-D0577 anti-human CD73 (Ecto-5'-nucleotidase) AD2 PG
Alexa Fluor® 700 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Alexa Fluor® 647 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Brilliant Violet 510™ anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
PerCP/Fire™ 780 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Spark Red™ 718 anti-hu CD73 (Ecto-5'-nucleotidase) (Flexi-Fluor™) AD2 FC
PerCP/Fire™ 806 anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Spark PLUS B550™ anti-human CD73 (Ecto-5'-nucleotidase) AD2 FC
Go To Top Version: 1    Revision Date: 08.12.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account