TotalSeq™-D0592 anti-human CD158b/j (KIR2DL2/L3/S2) Antibody

Pricing & Availability
Clone
DX27 (See other available formats)
Regulatory Status
RUO
Other Names
CD158b1 (KIR2DL2, p58.2), CD158b2 (KIR2DL3, p58.3), CD158j (KIR2DS2, p50.2), KIR-NKAT2
Isotype
Mouse IgG2a, κ
Barcode Sequence
GACCCGTAGTTTGAT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
312625 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD158b is expressed on natural killer cells and a subset of T cells. It is a member of the immunoglobulin superfamily containing two immunoglobulin C2-type domains. Both variants and alternative isoforms of CD158b have been reported. The interaction of CD158b with specific HLA-C antigens on a target cell (HLA-Cw1, HLA-Cw3, HLA-Cw7 alleles, for example) inhibits cytotoxicity and prevents target cell lysis and death. The interactions between KIR and MHC class I are thought to be important in NK cell and T cell regulation following antigen stimulation. The absence of ligands for KIRs may lower the threshold for activation through activating receptors and increase inflammation and susceptibility to autoimmune disease.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The DX27 monoclonal antibody reacts with a common epitope of KIR2DL2 (CD158b1, p58.2), KIR2DL3 (CD158b2, p58.3), and KIR2DS2 (CD158j, p50.2). Additional reported applications (for the relevant formats) include: restoring the NK cell cytotoxicity1,5.

This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Bakker ABH, et al. 1998. J. Immunol. 160:5239.
  2. Lucas M, et al. 2003. J. Virol. 77:2251.
  3. Goodier M, et al. 2000. J. Immunol. 165:139.
  4. Yawata M, et al. 2002. Immunogenetics 54:543.
  5. Valiante NM, et al. 1997. Immunity 7:739.

Antigen Details

Structure
Immunoglobulin superfamily member, contains two immunoglobulin C2-type domains, type I membrane protein
Distribution

NK cells and a subset of T cells

Function
Inhibits cytotoxic function of NK and T cells upon interacting with specific HLA-C antigens on target cell
Ligand/Receptor
HLA-C antigens such as HLA-Cw1, HLA-Cw3, HLA-Cw7
Cell Type
NK cells, T cells
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Colonna M, et al. 1995. Science 268:405.
2. Uhrburg M, et al. 1997. Immunity 7:753.
3. Wagtmann N, et al. 1995. Immunity 3:801.
4. Dohring C, et al. 1996. Immunogenetics 44:227.
5. Maenaka K, et al. 1999. Structure 7:391.

Gene ID
3803 View all products for this Gene ID
UniProt
View information about CD158b/j on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 01.01.0001

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account