TotalSeq™-D0593 anti-human CD203c (E-NPP3) Antibody

Pricing & Availability
Clone
NP4D6 (See other available formats)
Regulatory Status
RUO
Workshop
HLDA8
Other Names
E-NPP3, ENPP3
Isotype
Mouse IgG1, κ
Barcode Sequence
TAACCGTACCTGCAT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
324631 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD203c, a transmembrane protein and a member of the ectoenzyme family, is involved in the hydrolysis of extracellular oligonucleotides, nucleoside phosphates, and NAD (possesses ATPase and ATP pyrophosphatase activity). The molecular weight of CD203c is between 130 and 150 kD under reducing conditions and 270 kD under non-reducing conditions. CD203c is expressed on basophils and mast cells, and is highly expressed on activated basophils. Secretory glands in endometrium and glioma cells are also positive. CD203c is a multifunctional ectoenzyme involved in the clearance of extracellular nucleotides whose substrates include nucleoside triphosphates, nucleoside diphosphates, cAMP, and NAD.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
HEK-293 cells transfected with human E-NPP3
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Bühring HJ, et al. 1999. Blood 94:2343.
  2. Bühring HJ, et al. 2001. Blood 97:3303.
  3. Platz IJ, et al. 2001. Int. Arch. Allergy Immunol. 126:335.
  4. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  5. Gernez Y, et al. 2011. Int. Arch. Allergy Immunol. 154:318. (FC) PubMed
RRID
AB_2904345 (BioLegend Cat. No. 324631)

Antigen Details

Structure
Transmembrane ectoenzyme family member involved in the hydrolysis of extracellular oligonucleotides, nucleoside phosphates, and NAD (possesses ATPase and ATP pyrophosphatase activity); reduced molecular weight is 130 and 150 kD, unreduced is 270 kD
Distribution

Basophils and mast cells, highly expressed on activated basophils; secretory glands in endometrium and glioma cells are also positive

Function
Multifunctional ectoenzyme involved in the clearance of extracellular nucleotides
Ligand/Receptor
Substrates include nucleoside triphosphates, nucleoside diphosphates, cAMP, and NAD
Cell Type
Basophils, Mast cells
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Yano Y, et al. 2003. Int. J. Mol. Med. 12:763.
2. Andoh K, et al. 1999. Biochim. Biophys. Acta. 1446:213.

Gene ID
5169 View all products for this Gene ID
UniProt
View information about CD203c on UniProt.org
Go To Top Version: 1    Revision Date: 11.12.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account