- Clone
- RIK-2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Apo-2 ligand, Apo-2L, TNFSF10, CD253
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCCATTCCTGCCTAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
308223 | 10 µg | 369 CHF |
TRAIL is a 30 kD protein known as TNF-related apoptosis inducing ligand, CD253, TNFSF10, or Apo-2L. It can be expressed as a cell surface (30 kD) and soluble ligand (19-20 kD) produced by megakaryocytes and platelets, monocytes, neutrophils, NK cells and activated T cells. This antigen is also expressed on tumor cells and transformed cell lines. TRAIL has been reported to induce apoptosis in tumor and transformed cell lines by a caspase-dependent process. This antibody is useful for flow cytometric staining and blocking studies.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human TRAIL-transfected mouse cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: blocking1-4 of TRAIL-induced apoptosis and T cell mediated cytotoxicity. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 308214).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Kayagaki N, et al. 1999. J. Immunol. 162:2639. (Block)
- Uno K, et al. 2003. Blood 101:3658. (Block)
- Sato K, et al. 2005. J. Immunol. 174:4025. (Block)
- Denny MF, et al. 2007. Blood 110:2907. (Block)
- Kemter E, et al. 2011. Xenotransplantation. 19:40. PubMed
Antigen Details
- Structure
- TNF ligand superfamily member, approximately 30 kD
- Distribution
-
Widespread, highest expression in spleen, lung, prostate; NK, monocytes, neutrophils, activated T cells
- Function
- Induces apoptosis in tumorigenic and transformed cell lines, involved in T cell mediated cytotoxicity, TRAIL ligand of cognate receptors induces NF-κB signaling in a variety of cell types
- Ligand/Receptor
- DR4 and DR5 cognate receptors, also binds to the decoy receptors DcR1 and DcR2
- Cell Type
- Monocytes, Neutrophils, NK cells, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Pitti RM, et al. 1996. J. Biol. Chem. 271:12687.
2. Mariani SM, et al. 1998. Eur. J. Immunol. 28:973.
3. Dorothee G, et al. 2002. J. Immunol. 169:809.
4. Crist SA, et al. 2004. Exp. Hematology 32:1073. - Gene ID
- 8743 View all products for this Gene ID
- UniProt
- View information about CD253 on UniProt.org
Related FAQs
Other Formats
View All CD253 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD253 (TRAIL) | RIK-2 | FC,Block |
PE anti-human CD253 (TRAIL) | RIK-2 | FC |
APC anti-human CD253 (TRAIL) | RIK-2 | FC |
TotalSeq™-A0803 anti-human CD253 (TRAIL) | RIK-2 | PG |
Ultra-LEAF™ Purified anti-human CD253 (TRAIL) | RIK-2 | FC,Block |
PE/Cyanine7 anti-human CD253 (TRAIL) | RIK-2 | FC |
TotalSeq™-C0803 anti-human CD253 (TRAIL) | RIK-2 | PG |
TotalSeq™-B0803 anti-human CD253 (TRAIL) | RIK-2 | PG |
Brilliant Violet 421™ anti-human CD253 (TRAIL) Antibody | RIK-2 | FC |
TotalSeq™-D0803 anti-human CD253 (TRAIL) Antibody | RIK-2 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD253 (TRAIL)
-
PE anti-human CD253 (TRAIL)
Human TRAIL transfected cells stained with RIK-2 PE -
APC anti-human CD253 (TRAIL)
Human TRAIL transfected L5178Y cells were stained with CD253... -
TotalSeq™-A0803 anti-human CD253 (TRAIL)
-
Ultra-LEAF™ Purified anti-human CD253 (TRAIL)
-
PE/Cyanine7 anti-human CD253 (TRAIL)
hTRAIL transfected L5178Y cells were stained with CD253 (Tra... -
TotalSeq™-C0803 anti-human CD253 (TRAIL)
-
TotalSeq™-B0803 anti-human CD253 (TRAIL)
-
Brilliant Violet 421™ anti-human CD253 (TRAIL) Antibody
Human TRAIL transfected HEK293T cells were stained with anti... -
TotalSeq™-D0803 anti-human CD253 (TRAIL) Antibody
Follow Us