- Clone
- 509f6 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CD307, IRTA2, FcRH5, IFGP5, BXMAS1
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TCACGCAGTCCTCAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
340313 | 10 µg | 369 CHF |
FcRL5, also known as CD307e, CD307, IRTA2, FcRH5, and BXMAS1, is a 106 kD type I transmembrane glycoprotein composed of six-eight extracellular Ig like C2 domains and two cytoplasmic ITIM motifs. The FcRL5 gene is located on chromosome 1q21 and is normally expressed by tonsillar plasma cells and germinal center B cells. It has been suggested that FcRL5 contributes to B cell maturation and B cell receptor modulation. The identification of FcRL5 on a number of transformed cell types including hairy cell leukemia, mantle cell lymphoma, chronic lymphocytic lymphoma, and Burkitt’s lymphoma has prompted interest in it as a potential biomarker or target for immunotherapy. FcRL5 binds all aggregated IgG isotypes.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- P815 cells transfected with FcRL5
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunoprecipitation and blocking1. mAb 509f6 is able to block the binding of FcRL5 to all aggregated IgG isotypes.1
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Wilson TJ, et al. 2012. J. Immunol. 188:4741. (Block)
Antigen Details
- Structure
- 106 kD, Fc receptor like, type 1 transmembrane protein, 6-8 Ig like C2 domains, 2 cytoplasmic ITIM motifs.
- Distribution
-
Germinal center B cells, tonsillar plasma cells.
- Ligand/Receptor
- Aggregated IgG
- Cell Type
- B cells, Plasma cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Davis R, et al. 2007. Annu. Rev. Immunol. 207:528.
2. Mohan J, et al. 2006. Blood 107:4433.
3. Ise T, et al. 2007. Leukemia. 21:169. - Gene ID
- 83416 View all products for this Gene ID
- UniProt
- View information about CD307e on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All CD307e Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD307e (FcRL5) | 509f6 | FC,IP |
PE anti-human CD307e (FcRL5) | 509f6 | FC |
APC anti-human CD307e (FcRL5) | 509f6 | FC |
TotalSeq™-C0829 anti-human CD307e (FcRL5) | 509f6 | PG |
TotalSeq™-B0829 anti-human CD307e (FcRL5) Antibody | 509f6 | PG |
TotalSeq™-D0829 anti-human CD307e (FcRL5) | 509f6 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us