- Clone
- 17A12 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- IL-21 Receptor, novel interleukin receptor (NILR), MGC10967
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GAGGATGATGCCATG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
359521 | 10 µg | 369 CHF |
Human interleukin 21 receptor (IL-21R) is a single pass type I membrane protein and a member of the type I cytokine receptor family. Of the type I cytokine receptors, IL-21R exhibits greatest extracellular homology to the IL-2R beta subunit (i.e., it contains one copy of the WSXWS-containing cytokine-binding domain). Intracellular domains of IL-21R include the Box 1 and Box 2 elements, which are similar to the IL-9R intracellular region. Upon binding IL-21, IL-21R forms a heterodimer with the common gamma subunit (CD132) and induces Jak/Stat signaling. IL-21R is expressed on B cells and at various levels on NK and T cells. IL-21 is a potent immunomodulatory cytokine mainly produced by NKT and CD4 T-cells (particularly the inflammatory Th17 subset) and has pleiotropic effects on both innate and adaptive immune responses. These actions include positive effects such as enhanced proliferation of natural killer (NK) cells and cytotoxic T cells that can destroy virally infected or cancerous cells and direct inhibitory effects on the antigen-presenting function of dendritic cells, and can be proapoptotic for B cells and NK cells. Studies have shown that IL-21 is also an autocrine cytokine that potently induces Th17 differentiation and suppresses Foxp3 expression, and serves as a target for treating inflammatory diseases.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human IL-21R expressing mouse M1-T22 cell line.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunofluorescent surface staining1.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Bannantine J, et al. 2011. Front Microbiol. 2:163. (IF)
- RRID
-
AB_2904382 (BioLegend Cat. No. 359521)
Antigen Details
- Structure
- Single pass type I membrane protein, extracellular WSXWS-containing cytokine-binding domain, intracellular Box1 and Box2 domains
- Distribution
-
B cells, various levels on NK cells, T cells, NKT cells, B cells, DCs, macrophages, non-hematopoietic cells, including keratinocytes and fibroblasts
- Ligand/Receptor
- IL-21
- Cell Type
- B cells, Dendritic cells, Fibroblasts, Macrophages, NK cells, NKT cells, T cells, Tregs
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Parrish-Novak J, et al. 2002. J. Leukocyte Biol. 72:856.
2. de Totero D, et al. 2006. Blood 107:3708.
3. Asao H, et al. 2001. J. Immunol. 167:1.
4. Davis ID, et al. 2007. Clin. Cancer Res. 13:6926.
5. Nurieva R. 2007. Nature. 448:480.
6. Dumoutier L, et al. 2000. Proc. Natl. Acad. Sci. USA 97:10144.
7. Ozaki, K, et al. 2000. Proc. Natl. Acad. Sci. USA 97:11439.
8. Parrish-Novak J, et al. 2000. Nature 408:57.
9. Spolski R and Leonard WJ. et al. 2008. Annu. Rev. Immunol. 26:57. - Gene ID
- 50615 View all products for this Gene ID
- UniProt
- View information about CD360 on UniProt.org
Related FAQs
Other Formats
View All CD360 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD360 (IL-21R) | 17A12 | FC |
APC anti-human CD360 (IL-21R) | 17A12 | FC |
Brilliant Violet 421™ anti-human CD360 (IL-21R) | 17A12 | FC |
Brilliant Violet 711™ anti-human CD360 (IL-21R) | 17A12 | FC |
PE/Cyanine7 anti-human CD360 (IL-21R) | 17A12 | FC |
TotalSeq™-A0985 anti-human CD360 (IL-21R) Antibody | 17A12 | PG |
TotalSeq™-C0985 anti-human CD360 (IL-21R) Antibody | 17A12 | PG |
TotalSeq™-D0985 anti-human CD360 (IL-21R) | 17A12 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD360 (IL-21R)
-
APC anti-human CD360 (IL-21R)
-
Brilliant Violet 421™ anti-human CD360 (IL-21R)
-
Brilliant Violet 711™ anti-human CD360 (IL-21R)
-
PE/Cyanine7 anti-human CD360 (IL-21R)
-
TotalSeq™-A0985 anti-human CD360 (IL-21R) Antibody
-
TotalSeq™-C0985 anti-human CD360 (IL-21R) Antibody
-
TotalSeq™-D0985 anti-human CD360 (IL-21R)
Follow Us