- Clone
- S16020B (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Interleukin-12 receptor subunit beta-2
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TCCCTCAGCGATTTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
394203 | 10 µg | 369 CHF |
IL12RB2 is a type I transmembrane protein that foms an heterodimer with IL12RB1 to produce the high affinity IL-12 receptor complex. IL12RB2 is expressed by activated T cells, TH1 cells, NK cells, B cells and plasma cells. Variants of this gene are associated with predisposition to various immune-related diseases.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human IL12RB2 transfected cells.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894596 (BioLegend Cat. No. 394203)
Antigen Details
- Structure
- Type I transmembrane protein, 3 isoforms, foms an heterodimer with IL12RB1
- Distribution
-
Activated T cells, TH1 cells, NK cells, B cells, plasma cells
- Function
- Role in TH1 differentiation
- Ligand/Receptor
- IL-12
- Cell Type
- B cells, NK cells, Plasma cells, T cells, Th1
- Biology Area
- Immunology
- Molecular Family
- Cytokine/Chemokine Receptors
- Antigen References
-
- LaMere SA, et al. 2017. J Immunol. 199:3158
- Prigione I, et al. 2016. Immunobiology. 221:291
- de Paus RA, et al. 2013. Mol Immunol. 56:380
- Airoldi I, et al. 2008. Blood. 112:750
- Gene ID
- 3595 View all products for this Gene ID
- UniProt
- View information about IL12RB2 on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All IL12RB2 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human IL12RB2 | S16020B | FC |
TotalSeq™-D1172 anti-human IL12RB2 | S16020B | PG |
PE anti-human IL12RB2 | S16020B | FC |
Alexa Fluor® 647 anti-human IL12RB2 Antibody | S16020B | FC |
APC anti-human IL12RB2 | S16020B | FC |
Brilliant Violet 421™ anti-human IL12RB2 | S16020B | FC |
TotalSeq™-A1172 anti-human IL12RB2 | S16020B | PG |
TotalSeq™-C1172 anti-human IL12RB2 | S16020B | PG |
TotalSeq™-B1172 anti-human IL12RB2 | S16020B | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us