- Clone
- 5F10B29 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CKR1, CD191, HM145, SCYAR1, CMKRB1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CCTTTCCGACATTGG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
362919 | 10 µg | 369 CHF |
CD191, also known as CCR1, is a 41 kD, G-protein coupled receptor expressed predominantly by monocytes. CCR1 is also expressed by a subset of T cells and eosinophils. CCR1 positive cells can migrate in response to a CCL3 and CCL5 gradient. CCR1 knock-out studies suggest that this molecule plays an important role in inflammation and susceptibility to viruses and parasites.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human CCR1 transfected cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2936584 (BioLegend Cat. No. 362919)
Antigen Details
- Structure
- G-protein coupled receptor, seven transmembrane protein, 41 kD
- Distribution
-
Monocytes, macrophages, subset of T cells, eosinophils
- Function
- Regulates migration of cells in response to CCL3 and CCL5
- Ligand/Receptor
- CCL3 and CCL5
- Cell Type
- Eosinophils, Macrophages, Monocytes, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors, GPCR
- Antigen References
-
1. Su SB, et al. 1996. J. Leuko. Biol. 60:658.
2. Su S, et al. 1997. Blood. 90:605.
3. Ayehunie S, et al. 1997. Blood. 90:1379.
4. Gerard C, et al. 1997. J. Clin. Invest. 100:2022.
5. Tiffany HL, et al. 1998. J. Immunol. 160:1385.
6. Gilliland CT, et al. 2013. J. Biol. Chem. 288:32194.
7. Bednar F, et al. 2014. J. Immunol. 192:5305. - Gene ID
- 1230 View all products for this Gene ID
- UniProt
- View information about CD191 on UniProt.org
Related FAQs
Other Formats
View All CD191 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD191 (CCR1) | 5F10B29 | FC |
PE anti-human CD191 (CCR1) | 5F10B29 | FC |
Alexa Fluor® 488 anti-human CD191 (CCR1) | 5F10B29 | FC |
APC anti-human CD191 (CCR1) | 5F10B29 | FC |
PerCP/Cyanine5.5 anti-human CD191 (CCR1) | 5F10B29 | FC |
FITC anti-human CD191 (CCR1) | 5F10B29 | FC |
APC/Fire™ 750 anti-human CD191 (CCR1) | 5F10B29 | FC |
PE/Cyanine7 anti-human CD191 (CCR1) | 5F10B29 | FC |
APC/Cyanine7 anti-human CD191 (CCR1) | 5F10B29 | FC |
TotalSeq™-D1261 anti-human CD191 (CCR1) | 5F10B29 | PG |
TotalSeq™-A1261 anti-human CD191 (CCR1) | 5F10B29 | PG |
TotalSeq™-B1261 anti-human CD191 (CCR1) | 5F10B29 | PG |
TotalSeq™-C1261 anti-human CD191 (CCR1) | 5F10B29 | PG |
PE/Dazzle™ 594 anti-human CD191 (CCR1) | 5F10B29 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with purified ... -
PE anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with CD191 (CC... -
Alexa Fluor® 488 anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with CD191 (cl... -
APC anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with CD191 (cl... -
PerCP/Cyanine5.5 anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with CD191 Per... -
FITC anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with CD191 FIT... -
APC/Fire™ 750 anti-human CD191 (CCR1)
Human peripheral blood monocytes were treated with human Tru... -
PE/Cyanine7 anti-human CD191 (CCR1)
Human TruStain FcX™ (Cat. No. 422302) treated human peripher... -
APC/Cyanine7 anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with CD191 (cl... -
TotalSeq™-D1261 anti-human CD191 (CCR1)
-
TotalSeq™-A1261 anti-human CD191 (CCR1)
-
TotalSeq™-B1261 anti-human CD191 (CCR1)
-
TotalSeq™-C1261 anti-human CD191 (CCR1)
-
PE/Dazzle™ 594 anti-human CD191 (CCR1)
Human peripheral blood monocytes were stained with anti-huma...
Follow Us