TotalSeq™-D0089 anti-human TIGIT (VSTM3) Antibody

Pricing & Availability
Clone
A15153G (See other available formats)
Regulatory Status
RUO
Other Names
T-cell immunoreceptor with Ig and ITIM domains, VSIG9, VSTM3, WUCAM
Isotype
Mouse IgG2a, κ
Barcode Sequence
TTGCTTACCGCCAGA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
372739 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

T cell immunoreceptor with Ig and ITIM domains (TIGIT), also known as VSTM3 or WUCAM, is a 26 kD, type I transmembrane protein and is a member of the PVR (poliovirus receptor) family of immunoglobulin-like domain containing proteins. TIGIT is expressed on activated T cells, follicular T helper, memory, and regulatory T cells as well as on NK cells. TIGIT is a negative regulator of NK and T cell activation. Expression of TIGIT is associated with decreased functionality of CD8 T cells in chronic viral infection and tumors. TIGIT also promotes the differentiation of tolerogenic phenotype in dendritic cells with an increased secretion of IL-10 and a diminished production of IL-12.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Recombinant Human TIGIT.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

This clone can suppress anti-CD3 induced T cell proliferation in vitro based on in-house testing.

This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).

Additional reported applications (for the relevant formats) include: Blocking1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Stamm H, et al. 2018. Oncogene. Pubmed
RRID
AB_2892456 (BioLegend Cat. No. 372739)

Antigen Details

Structure
26kD; type I transmembrane protein, Ig-like V-type domain, ITIM motif.
Distribution

Activated T cells, Regulatory T cells (Treg), Follicular Helper T cells (TFH), NK cells.

Function
Cell signaling, negative regulation of T cells, T cell tolerance, T cell anergy.
Ligand/Receptor
CD155 (PVR), CD112 (PVRL2, NECTIN-2).
Cell Type
NK cells, T cells, Tfh, Tregs
Biology Area
Cell Adhesion, Cell Biology, Immunology, Inhibitory Molecules, Signal Transduction
Molecular Family
Adhesion Molecules, Immune Checkpoint Receptors
Antigen References

1. Stanietsky N, et al. 2009. Proc. Natl. Acad. Sci. 106:17858.
2. Yu X, et al. 2009. Nat. Immunol. 10:48.
3. Johnston R, et al. 2014. Cancer Cell. 26:923.

Gene ID
201633 View all products for this Gene ID
UniProt
View information about TIGIT on UniProt.org

Other Formats

View All TIGIT (VSTM3) Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human TIGIT (VSTM3) A15153G FC,Block
APC/Fire™ 750 anti-human TIGIT (VSTM3) A15153G FC
APC anti-human TIGIT (VSTM3) A15153G FC
PE anti-human TIGIT (VSTM3) A15153G FC
Brilliant Violet 421™ anti-human TIGIT (VSTM3) A15153G FC
Brilliant Violet 605™ anti-human TIGIT (VSTM3) A15153G FC
PE/Dazzle™ 594 anti-human TIGIT (VSTM3) A15153G FC
PerCP/Cyanine5.5 anti-human TIGIT (VSTM3) A15153G FC
PE/Cyanine7 anti-human TIGIT (VSTM3) A15153G FC
Ultra-LEAF™ Purified anti-human TIGIT (VSTM3) A15153G FC
Biotin anti-human TIGIT (VSTM3) A15153G FC
Alexa Fluor® 647 anti-human TIGIT (VSTM3) A15153G FC
TotalSeq™-A0089 anti-human TIGIT (VSTM3) A15153G PG
TotalSeq™-B0089 anti-human TIGIT (VSTM3) A15153G PG
TotalSeq™-C0089 anti-human TIGIT (VSTM3) A15153G PG
KIRAVIA Blue 520™ anti-human TIGIT (VSTM3) A15153G FC
APC/Cyanine7 anti-human TIGIT (VSTM3) A15153G FC
Brilliant Violet 510™ anti-human TIGIT (VSTM3) A15153G FC
Brilliant Violet 785™ anti-human TIGIT (VSTM3) Antibody A15153G FC
TotalSeq™-D0089 anti-human TIGIT (VSTM3) A15153G PG
Brilliant Violet 711™ anti-human TIGIT (VSTM3) A15153G FC
PE/Fire™ 640 anti-human TIGIT (VSTM3) A15153G FC
PE/Fire™ 810 anti-human TIGIT (VSTM3) A15153G FC
PE/Cyanine5 anti-human TIGIT (VSTM3) A15153G FC
PerCP/Fire™ 806 anti-human TIGIT (VSTM3) A15153G FC
PerCP/Fire™ 780 anti-human TIGIT (VSTM3) A15153G FC
Spark Red™ 718 anti-human TIGIT (VSTM3) (Flexi-Fluor™) A15153G FC
PE/Fire™ 700 anti-human TIGIT (VSTM3) A15153G FC
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account