TotalSeq™-D0100 anti-human CD20 Antibody

Pricing & Availability
Clone
2H7 (See other available formats)
Regulatory Status
RUO
Workshop
IV B201
Other Names
B1, Bp35
Isotype
Mouse IgG2b, κ
Barcode Sequence
TTCTGGGTCCCTAGA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
302370 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD20 is a 33-37 kD, four transmembrane spanning protein, also known as B1 and Bp35. CD20 is expressed on pre-B-cells, resting and activated B cells (not plasma cells), some follicular dendritic cells, and at low levels on a T cell subset. CD20 is heavily phosphorylated on activated B cells and malignant B cells. Homo-oligomeric complexes of CD20 are thought to form Ca2+ conductive ion channels in the plasma membrane of B cells. The CD20 molecule is involved in B-cell activation and is associated with various Src family kinases (Lyn, Lck, Fyn). It exists in a complex with MHC class I and II, CD53, CD81, and CD82.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
Baboon, Capuchin Monkey, Chimpanzee, Pigtailed Macaque, Squirrel Monkey
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human tonsillar B cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The epitope recognized by clone 2H7 has been mapped to the sequence YNCEPANPSEKNSPST which lies in the large extracellular loop of human CD20. Additional reported applications (for the relevant formats) include: immunoprecipitation4 and immunohistochemical staining of acetone-fixed frozen sections5.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  3. McMichael A, et al. Eds. 1987. Leucocyte Typing III Oxford University Press. New York.
  4. Polyak MJ, et al. 2002. Blood 99:3256. (IP)
  5. Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
RRID
AB_2922531 (BioLegend Cat. No. 302370)

Antigen Details

Structure
Four transmembrane protein (TM4SF), heavily phosphorylated after activation, 33-37 kD
Distribution

B cell, T cell subsets

Function
B cell activation
Ligand/Receptor
Src family tyrosine kinases, MHC class I, II, CD53, CD81, CD82
Cell Type
B cells, T cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Hultin L, et al. 1993. Cytometry 14:196.
2. Tedder T, et al. 1994. Immunol. Today 15:450.

Gene ID
931 View all products for this Gene ID
UniProt
View information about CD20 on UniProt.org

Related FAQs

What is the difference between two anti human CD20 clones 2H7 and 1412?

For clone 1412: This clone specifically recognizes cytoplasmic domain of CD20 and thus can only be used for intracellular flow cytometry. In this instance you will need to include the fixation and permeabilization steps. Please follow the intracellular flow cytometry staining protocol.

For clone 2H7: This clone is ok for regular surface staining for CD20 and there is no need for any fixation and permeabilization steps.

Our technical protocols can be found here.

Other Formats

View All CD20 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human CD20 2H7 FC
FITC anti-human CD20 2H7 FC
PE anti-human CD20 2H7 FC
PE/Cyanine5 anti-human CD20 2H7 FC
Purified anti-human CD20 2H7 FC,CyTOF®,IHC-F,IP
APC/Cyanine7 anti-human CD20 2H7 FC
PE/Cyanine7 anti-human CD20 2H7 FC
Alexa Fluor® 488 anti-human CD20 2H7 FC,IHC-F
Alexa Fluor® 647 anti-human CD20 2H7 FC,IHC-F
Pacific Blue™ anti-human CD20 2H7 FC
Alexa Fluor® 700 anti-human CD20 2H7 FC
PerCP anti-human CD20 2H7 FC
PerCP/Cyanine5.5 anti-human CD20 2H7 FC
Brilliant Violet 421™ anti-human CD20 2H7 FC,IHC-F
Brilliant Violet 570™ anti-human CD20 2H7 FC
Brilliant Violet 605™ anti-human CD20 2H7 FC
Brilliant Violet 650™ anti-human CD20 2H7 FC
Brilliant Violet 785™ anti-human CD20 2H7 FC
Brilliant Violet 510™ anti-human CD20 2H7 FC
Brilliant Violet 711™ anti-human CD20 2H7 FC
Purified anti-human CD20 (Maxpar® Ready) 2H7 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD20 2H7 FC
Biotin anti-human CD20 2H7 FC
APC/Fire™ 750 anti-human CD20 2H7 FC
Alexa Fluor® 594 anti-human CD20 2H7 ICC,IHC-F
FITC anti-human CD20 2H7 FC
Pacific Blue™ anti-human CD20 2H7 FC
APC anti-human CD20 2H7 FC
PE/Cyanine7 anti-human CD20 2H7 FC
TotalSeq™-A0100 anti-human CD20 2H7 PG
TotalSeq™-B0100 anti-human CD20 2H7 PG
TotalSeq™-C0100 anti-human CD20 2H7 PG
PerCP/Cyanine5.5 anti-human CD20 2H7 FC
Spark NIR™ 685 anti-human CD20 2H7 FC
Spark YG™ 593 anti-human CD20 2H7 FC
GMP FITC anti-human CD20 2H7 FC
TotalSeq™-D0100 anti-human CD20 2H7 PG
GMP APC anti-human CD20 2H7 FC
Spark Violet™ 500 anti-human CD20 2H7 FC
GMP Pacific Blue™ anti-human CD20 2H7 FC
GMP PerCP/Cyanine5.5 anti-human CD20 2H7 FC
Spark Violet™ 538 anti-human CD20 2H7 FC
APC/Fire™ 750 anti-human CD20 2H7 FC
PE anti-human CD20 2H7 FC
GMP PE/Cyanine7 anti-human CD20 2H7 FC
Spark Blue™ 515 anti-human CD20 2H7 FC
GMP APC/Fire™ 750 anti-human CD20 2H7 FC
GMP PE anti-human CD20 2H7 FC
Spark Blue™ 550 anti-human CD20 (Flexi-Fluor™) 2H7 FC
Spark Blue™ 574 anti-human CD20 (Flexi-Fluor™) 2H7 FC
Spark Red™ 718 anti-human CD20 (Flexi-Fluor™) 2H7 FC
APC/Fire™ 810 anti-human CD20 2H7 FC
Alexa Fluor® 660 anti-human CD20 2H7 FC
Go To Top Version: 1    Revision Date: 03/23/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account