IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0124 anti-human CD31 Antibody

Pricing & Availability
Clone
WM59 (See other available formats)
Regulatory Status
RUO
Workshop
V P025
Other Names
PECAM-1, EndoCAM
Isotype
Mouse IgG1, κ
Barcode Sequence
ACCTTTATGCCACGG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
303151 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD31 is a 130-140 kD type I transmembrane glycoprotein also known as platelet endothelial cell adhesion molecule-1 (PECAM-1) or Endocam. It is expressed on monocytes, platelets, granulocytes, endothelial cells and lymphocyte subsets. CD31 has been reported to bind CD38 and be involved in wound healing, angiogenesis, and cellular migration in an inflammatory situation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone WM59 has been reported to recognize the D2 extracellular portion of CD31.

Additional reported applications (for the relevant formats) include: immunofluorescence microscopy2, immunohistochemical staining of acetone-fixed frozen tissue sections8, blocking of platelet aggregation3, and spatial biology (IBEX)11,12. Clone WM59 is not recommended for immunohistochemical staining of formalin-fixed paraffin-embedded sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 303143 & 303144).

The purified WM59 antibody is useful as a capture antibody for a sandwich ELISA assay, when used in conjunction with biotin anti-human CD31 antibody (Cat. No. 536604) antibody as the detection antibody.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V Oxford University Press. New York.
  2. Muczynski KA, et al. 2003. J. Am. Soc. Nephrol. 14:1336. (IF)
  3. Wu XW, et al. 1997. Arterioscl. Throm. Vas. 17:3154. (Block)
  4. Nagano M, et al. 2007. Blood 110:151. (FC) PubMed
  5. MacFadyen JR, et al. 2005. FEBS Lett. 579:2569. PubMed
  6. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  7. Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21.
  8. Wicki A, et al. 2012. Clin. Cancer Res. 18:454. (FC, IHC) PubMed
  9. Oeztuerk-Winder F, et al. 2012. EMBO J. 31:3431. (FC) PubMed
  10. Bushway ME, et al. 2014. Biol Reprod. 90(5): 110 (IF) PubMed
  11. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  12. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2922535 (BioLegend Cat. No. 303151)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, 130-140 kD
Distribution

Monocytes, platelets, granulocytes, endothelial cells, lymphocyte subset

Function
Cell adhesion, signal transduction
Ligand/Receptor
CD38
Cell Type
Endothelial cells, Granulocytes, Lymphocytes, Monocytes, Neutrophils, Platelets
Biology Area
Angiogenesis, Cell Adhesion, Cell Biology, Immunology, Neuroinflammation, Neuroscience
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References
  1. DeLisser H, et al. 1994. Immunol. Today 15:490.
  2. Newman P, 1997. J. Clin. Invest. 99:3.
  3. Fawcett J, et al. 1995. J. Cell Biol. 128:1229.
Gene ID
5175 View all products for this Gene ID
UniProt
View information about CD31 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 03/17/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account