- Clone
- M1/42; 30-F11;
- Regulatory Status
- RUO
- Other Names
- Mouse major histocompatibility complex H-2, MHC, T200, Ly-5, LCA
- Isotype
- Rat IgG2a, κ/Rat IgG2b, κ
- Barcode Sequence
- ACCCACCAGTAAGAC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
113902 | 10 µg | 414€ |
TotalSeq™ anti-mouse Hashtag reagent is a mixture of two monoclonal antibodies conjugated to the same oligonucleotide. The antibodies are specific against mouse CD45 and MHC class I (of a, b, d, j, k, s, and u haplotypes) and can be used to label hematopoietic and non-hematopoietic cells in most commonly used mouse strains for multiplex single cell sequencing analysis. The conjugated antibodies are pre-mixed to be used following an optimized protocol similar to the CITE-seq workflow.
CD45 is a 180-240 kD glycoprotein also known as the leukocyte common antigen (LCA), T200, or Ly-5. It is a member of the protein tyrosine phosphatase (PTP) family, expressed on all hematopoietic cells except mature erythrocytes and platelets. CD45 plays a key role in TCR and BCR signal transduction.
MHC class I is involved in antigen presentation to T cells expressing CD3/TCR and CD8 proteins. The M1/42 antibody reacts with the H-2 MHC class I alloantigens expressed on nucleated cells from mice of the a, b, d, j, k, s, and u haplotypes (Stallcup, KC et al, 1981).
Importantly, some cell lines or experimental models may lack or express very low levels of either or both CD45 and MHC I molecules. We recommend a pilot experiment before single cell proteogenomics to confirm expression of these molecules in your experimental system. Different mouse strains express different MHC I haplotypes. Please refer to the supplemental table for detailed information about the haplotype of your experimental model. The supplemental table and summary below are not exhaustive and provide just a summary of common laboratory mouse strains recognized by TotalSeq™ anti-mouse Hashtags.
Mouse strains recognized by clone M1/42: 129/-; A/J; AKR/J; BALB/cAnN; BALB/cBy; BALB/CJ; BXSB/Mp; C3H/Bi; C3H/He; C3HeB/FeJ; C57BL/6; C57BL/10; C57BLR/cdj; C57L/J; C58/J; C.B-17; CBA/Ca; CBA/J; CBA/N; CE/J; DA/HuSn; GRS/J; HRS/J; I/LnJ; LP/J; MA/MyJ; MRL/Mp; NOD; NZB/-; PL/J; RF/J; SEC/-; SJL/J; ST/bJ; SWR/J.
Strains that are not recognized by clone M1/42: BDP/J; BUB/BnJ; DBA/1; FVB/N; NZW/-; P/J; SM/J.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 0.5 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_3683141 (BioLegend Cat. No. 113902)
Antigen Details
- Cell Type
- Mesenchymal Stem Cells
- Biology Area
- Stem Cells
- Gene ID
- 111364 View all products for this Gene ID 19264 View all products for this Gene ID
- UniProt
- View information about H-2/CD45 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All H-2/CD45 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
TotalSeq™-A0301 anti-mouse Hashtag 1
-
TotalSeq™-A0302 anti-mouse Hashtag 2
-
TotalSeq™-A0303 anti-mouse Hashtag 3
-
TotalSeq™-A0304 anti-mouse Hashtag 4
-
TotalSeq™-A0305 anti-mouse Hashtag 5
-
TotalSeq™-A0306 anti-mouse Hashtag 6
-
TotalSeq™-A0307 anti-mouse Hashtag 7
-
TotalSeq™-A0308 anti-mouse Hashtag 8
-
TotalSeq™-A0309 anti-mouse Hashtag 9
-
TotalSeq™-A0310 anti-mouse Hashtag 10
-
TotalSeq™-A0311 anti-mouse Hashtag 11
-
TotalSeq™-A0312 anti-mouse Hashtag 12
-
TotalSeq™-A0313 anti-mouse Hashtag 13
-
TotalSeq™-A0314 anti-mouse Hashtag 14
-
TotalSeq™-A0315 anti-mouse Hashtag 15
-
TotalSeq™-C0301 anti-mouse Hashtag 1
-
TotalSeq™-C0302 anti-mouse Hashtag 2
-
TotalSeq™-C0303 anti-mouse Hashtag 3
-
TotalSeq™-C0304 anti-mouse Hashtag 4
-
TotalSeq™-C0305 anti-mouse Hashtag 5
-
TotalSeq™-B0301 anti-mouse Hashtag 1
-
TotalSeq™-B0302 anti-mouse Hashtag 2
-
TotalSeq™-B0303 anti-mouse Hashtag 3
-
TotalSeq™-B0304 anti-mouse Hashtag 4
-
TotalSeq™-B0305 anti-mouse Hashtag 5
-
TotalSeq™-B0306 anti-mouse Hashtag 6
-
TotalSeq™-B0307 anti-mouse Hashtag 7
-
TotalSeq™-B0308 anti-mouse Hashtag 8
-
TotalSeq™-B0309 anti-mouse Hashtag 9
-
TotalSeq™-B0310 anti-mouse Hashtag 10
-
TotalSeq™-C0306 anti-mouse Hashtag 6
-
TotalSeq™-C0307 anti-mouse Hashtag 7
-
TotalSeq™-C0308 anti-mouse Hashtag 8
-
TotalSeq™-C0309 anti-mouse Hashtag 9
-
TotalSeq™-C0310 anti-mouse Hashtag 10
-
TotalSeq™-C0311 anti-mouse Hashtag 11
-
TotalSeq™-C0312 anti-mouse Hashtag 12
-
TotalSeq™-C0313 anti-mouse Hashtag 13
-
TotalSeq™-C0314 anti-mouse Hashtag 14
-
TotalSeq™-C0315 anti-mouse Hashtag 15
-
TotalSeq™-C0316 anti-mouse Hashtag 16
-
TotalSeq™-C0326 anti-mouse Hashtag 20
-
TotalSeq™-C0325 anti-mouse Hashtag 19
-
TotalSeq™-A0325 anti-mouse Hashtag 19
-
TotalSeq™-A0326 anti-mouse Hashtag 20
-
TotalSeq™-B0317 anti-mouse Hashtag 17
-
TotalSeq™-B0318 anti-mouse Hashtag 18
-
TotalSeq™-B0326 anti-mouse Hashtag 20
-
TotalSeq™-B0325 anti-mouse Hashtag 19
-
TotalSeq™-B0312 anti-mouse Hashtag 12
-
TotalSeq™-B0313 anti-mouse Hashtag 13
-
TotalSeq™-B0314 anti-mouse Hashtag 14
-
TotalSeq™-B0315 anti-mouse Hashtag 15
-
TotalSeq™-B0316 anti-mouse Hashtag 16
-
TotalSeq™-B0311 anti-mouse Hashtag 11
-
TotalSeq™-A0316 anti-mouse Hashtag 16
-
TotalSeq™-A0321 anti-mouse Hashtag 21
-
TotalSeq™-C0321 anti-mouse Hashtag 21
-
TotalSeq™-C0318 anti-mouse Hashtag 18
-
TotalSeq™-C0317 anti-mouse Hashtag 17
-
TotalSeq™-C0322 anti-mouse Hashtag 22
-
TotalSeq™-C0323 anti-mouse Hashtag 23
-
TotalSeq™-C0324 anti-mouse Hashtag 24
-
TotalSeq™-A0317 anti-mouse Hashtag 17
-
TotalSeq™-A0318 anti-mouse Hashtag 18
-
TotalSeq™-A0322 anti-mouse Hashtag 22
-
TotalSeq™-B0322 anti-mouse Hashtag 22
-
TotalSeq™-A0323 anti-mouse Hashtag 23
-
TotalSeq™-B0324 anti-mouse Hashtag 24
-
TotalSeq™-B0321 anti-mouse Hashtag 21
-
TotalSeq™-B0323 anti-mouse Hashtag 23
-
TotalSeq™-A0324 anti-mouse Hashtag 24
-
TotalSeq™-D0301 anti-mouse Hashtag 1
-
TotalSeq™-D0302 anti-mouse Hashtag 2
Follow Us