- Clone
- CD43-10G7 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Ly-48, Leukosialin, Sialophorin, Leukocyte Sialoglycoprotein
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GATTAACCAGCTCAT
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
343211 | 10 µg | 296€ |
CD43, also known as Ly-48, leukosialin, sialophorin, leukocyte sialoglycoprotein, and W3/13, is a large single chain, type I transmembrane glycoprotein with abundant O-glycosylation and sialylation sites. It has been reported that CD43 binds to CD54 and Siglec-1. CD43 plays dual roles in cell adhesion and anti-adhesion as well as costimulation of T cell activation and survival, and induction of apoptosis of T cells and hematopoietic progenitors.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- MV4-11 cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Rosenkranz AR, et al. 1993. Immunology. 80:431
- Skubitz KM, et al. 1998. J. Leukoc. Biol. 64:800
- RRID
-
AB_2922561 (BioLegend Cat. No. 343211)
Antigen Details
- Structure
- Single chain, type I transmembrane glycoprotein with abundant O-glycosylation and sialylation sites, 95-130 kD.
- Distribution
-
Most hematopoietic cells, including peripheral T cells, NK cells, granulocytes, monocytes, thymocytes, platelets, plasma cells, activated B cells, and hemotopoietic progenitor cells.
- Function
- Plays dual roles in cell-cell adhesion and anti-adhesion, costimulation of cell activation and survival, inducing apoptosis of T cells and hematopoietic progenitors.
- Ligand/Receptor
- CD54, Siglec-1
- Biology Area
- Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Neil Barclay A, et al. 1997. The Leucocyte Antigen Facts Book:Second Edition. Page 238
2. Killeen A, et al. 1987. EMBO J. 6:4029.
3. Thurman EC, et al. 1998. Intl. Immunol. 10:691.
4. Onami TM, et al. 2002. J. Immunol. 168:6022.
5. Tong J, et al. 2004. J. Exp. Med. 199:1277.
6. Jones AT, et al. 1994. J. Immunol. 153:3426. - Gene ID
- 6693 View all products for this Gene ID
- UniProt
- View information about CD43 on UniProt.org
Related FAQs
Other Formats
View All CD43 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD43 | CD43-10G7 | FC,IP |
PE anti-human CD43 | CD43-10G7 | FC |
APC anti-human CD43 | CD43-10G7 | FC |
PE/Cyanine7 anti-human CD43 | CD43-10G7 | FC |
TotalSeq™-A0357 anti-human CD43 | CD43-10G7 | PG |
TotalSeq™-D0357 anti-human CD43 | CD43-10G7 | PG |
TotalSeq™-C0357 anti-human CD43 | CD43-10G7 | PG |
TotalSeq™-B0357 anti-human CD43 | CD43-10G7 | PG |
PE/Fire™ 640 anti-human CD43 | CD43-10G7 | FC |
APC/Fire™ 750 anti-human CD43 | CD43-10G7 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD43
Human peripheral blood lymphocytes stained with CD43-10G7 PE... -
PE anti-human CD43
Human peripheral blood lymphocytes stained with CD43-10G7 PE... -
APC anti-human CD43
Human peripheral blood lymphocytes stained with CD3 (UCHT1) ... -
PE/Cyanine7 anti-human CD43
Human peripheral blood lymphocytes were stained with CD43 (c... -
TotalSeq™-A0357 anti-human CD43
-
TotalSeq™-D0357 anti-human CD43
-
TotalSeq™-C0357 anti-human CD43
-
TotalSeq™-B0357 anti-human CD43
-
PE/Fire™ 640 anti-human CD43
Human lysed whole blood was stained with anti-human CD43 (cl... Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 750 anti-human CD43
Human lysed whole blood was stained with anti-human CD43 (cl... Human peripheral blood lymphocytes were stained with anti-hu...
Follow Us