- Clone
- CY1G4 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- A015
- Other Names
- T9, Transferrin receptor
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CCGTGTTCCTCATTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
334133 | 10 µg | 296€ |
CD71 is a 95 kD type II homodimeric transmembrane glycoprotein also known as T9 and transferrin receptor. It is expressed on proliferating cells, reticulocytes, and erythroid precursors. CD71 plays a role in the control of cellular proliferation by facilitating the uptake of iron via ferrotransferrin binding and the recycling of apotransferrin to the cell surface.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- NALM-6 pre-B cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- RRID
-
AB_2892405 (BioLegend Cat. No. 334133)
Antigen Details
- Structure
- Transferrin receptor family, type II glycoprotein, 95 kD
- Distribution
-
Proliferating cells, reticulocytes, erythroid precursors
- Function
- Mediates uptake of iron
- Ligand/Receptor
- Transferrin
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Hentze M, et al. 1996. P. Natl. Acad. Sci. USA 93:8175.
2. Trowbridge I, et al. 1993. Annu. Rev. Cell Biol. 9:129. - Gene ID
- 7037 View all products for this Gene ID
- UniProt
- View information about CD71 on UniProt.org
Other Formats
View All CD71 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD71
-
FITC anti-human CD71
-
PE anti-human CD71
-
APC anti-human CD71
-
APC/Cyanine7 anti-human CD71
-
PE/Cyanine7 anti-human CD71
-
PerCP/Cyanine5.5 anti-human CD71
-
Alexa Fluor® 647 anti-human CD71
-
Brilliant Violet 650™ anti-human CD71
-
Brilliant Violet 421™ anti-human CD71
-
PE/Dazzle™ 594 anti-human CD71
-
TotalSeq™-A0394 anti-human CD71
-
TotalSeq™-C0394 anti-human CD71
-
TotalSeq™-B0394 anti-human CD71
-
Alexa Fluor® 700 anti-human CD71 Antibody
-
TotalSeq™-D0394 anti-human CD71
-
APC anti-human CD71
-
FITC anti-human CD71
-
APC/Fire™ 750 anti-human CD71
-
PE/Cyanine7 anti-human CD71
-
APC/Fire™ 750 anti-human CD71
-
PE/Cyanine5 anti-human CD71
-
PE/Fire™ 700 anti-human CD71
-
PE/Fire™ 640 anti-human CD71
-
Spark YG™ 593 anti-human CD71
-
Spark Violet™ 423 anti-human CD71
-
GMP PE/Cyanine7 anti-human CD71
-
Spark Blue™ 574 anti-human CD71
-
Spark Red™ 718 anti-human CD71 (Flexi-Fluor™)
Follow Us