TotalSeq™-D0397 anti-human CD193 (CCR3) Antibody

Pricing & Availability
Clone
5E8 (See other available formats)
Regulatory Status
RUO
Other Names
CC CKR3, MIP1-alpha receptor like-2, eotaxin receptor, CD193, CCR3
Isotype
Mouse IgG2b, κ
Barcode Sequence
ACCAATCCTTTCGTC
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
310735 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD193, also known as CC-chemokine receptor 3 (CCR3), CC CKR3, MIP1-alpha receptor like-2, and eotaxin receptor, is a member of the G protein-coupled seven transmembrane receptors family. It binds to the CC chemokines eotaxin, eotaxin-2, and eotaxin-3 with high affinity. CCR3 has also been reported to bind RANTES, MCP-3, and MCP-4 with low affinity. CCR3 receptor is expressed on human eosinophils, basophils, mast cells, mononuclear phagocytes, platelets, CD34+ hematopoietic progenitor cells, Th2-like lymphocytes, and keratinocytes. CCR3 is thought to play a role in allergic diseases such as bronchial asthma and allergic rhinitis. CCR3 is a co-receptor for HIV-1 and HIV-2, and the binding of eotaxin with CCR3 has been shown to inhibit HIV infection in some cell types.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: The 5E8 antibody is useful for immunofluorescent staining and flow cytometric analysis of CCR3 expression.

It has been observed that the 5E8 antibody clone can interact with PE/Cyanine7 antibody conjugates during multi-color staining, potentially leading to unwanted staining. This interaction can be resolved by sequentially staining with the 5E8 antibody first and then followed by the PE/Cyanine7 conjugate of interest.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Beauvillian C, et al. 2011. Blood 117:1196. PubMed
RRID
AB_2904338 (BioLegend Cat. No. 310735)

Antigen Details

Structure
G-protein coupled seven transmembrane domain receptor, 356 amino acids
Distribution

Eosinophils, basophils, mast, mononuclear phagocytes, platelets, CD34+ hematopoietic progenitor, Th2, keratinocytes

Function
Co-receptor for HIV-1 and HIV-2, allergy
Receptors
Eotaxin, eotaxin-2, eotaxin-3
Cell Type
Eosinophils, Erythrocytes, Hematopoietic stem and progenitors, Macrophages, Mast cells, Thymocytes
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Gerard W, et al. 1996. J. Exp. Med. 183:2437.
2. Uguccioni C, et al. 1997. J. Clin. Invest. 100:1137.
3. Sallusto F, et al. 1997. Science. 277:2005.
4. Loetscher P, et al. 2001. J. Biol. Chem. 276:2986.

Regulation
Upregulated by high affinity Fc IgE receptor ligation (mast cells), RANTES (keratinocytes), IFNg (monocytes, neutrophils), HIV tat protein (basophils), IL-3, IL-5 and GM-CSF (CD34+ progenitor cells), IL-2 and IL-4(T cells). Downregulated by IL-
Gene ID
1232 View all products for this Gene ID
UniProt
View information about CD193 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Go To Top Version: 1    Revision Date: 11/15/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account