TotalSeq™-D0400 anti-human CD144 (VE-Cadherin) Antibody

Pricing & Availability
Clone
BV9 (See other available formats)
Regulatory Status
RUO
Other Names
VE-Cadherin, cadherin-5, CDH5
Isotype
Mouse IgG2a, κ
Barcode Sequence
TCCACTCATTCTGTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
348525 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD144, also known as VE-cadherin and cadherin-5, is a 140 kD glycoprotein which is composed of five extracellular cadherin repeats and a highly conserved cytoplasmic tail region. It is a calcium-dependent transmembrane cell-cell adhesion molecule localized at the intercellular boundaries of endothelial cells, hematopoietic stem cells, and perineurial cells. It functions as a classic cadherin by mediating homophilic adhesion and functions as a plasma membrane attachment site for the cytoskeleton. CD144 is thought to play a role in vascular development, permeability, and remodeling.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Clone BV9 has been shown to block VE-cadherin, causing a redistribution of VE-cadherin away from intracellular junctions.6 This clone binds to EC3-EC4 region in the extracellular domain of human VE-cadherin.7 Additional reported applications (for the relevant formats) include: Western Blotting1,2, immunofluorescence microscopy1,3, immunoprecipitation1,4, blocking angiogenesis in vitro4,5, inhibiting VE-cadherin reorganization4, and inducing endothelial cell apoptosis4.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Almagro S, et al. 2010. Mol. Cell Biol. 30:1703. (WB, IF, IP)
  2. Zhang F, et al. 2004. J. Biol. Chem. 279:11760. (WB)
  3. Iurlaro M, et al. 2004. Am. J. Pathol. 165:181. (IF)
  4. Corada M, et al. 2001. Blood 97:1679. (IP, Block)
  5. Kooistra M, et al. 2005. FEBS 579:4966. (Block)
  6. Corada M, et al. 2001. Blood 97:1679. (Block)
  7. Bouillet L, et al. 2013. Laboratory Investigation 93:1194-11202.

Antigen Details

Structure
Member of the cadherin family; calcium-dependent transmembrane cell-cell adhesion glycoprotein composed of five extracellular cadherin repeats and a highly conserved cytoplasmic tail region
Distribution

Endothelial cells, hematopoietic stem cells, perineurial cells

Function
Mediates calcium-dependent homophilic cell adhesion, plays fundamental roles in microvascular permeability and in the morphogenic and proliferative events associated with angiogenesis
Ligand/Receptor
VE-cadherin
Cell Type
Endothelial cells, Hematopoietic stem and progenitors, Mesenchymal Stem Cells
Biology Area
Angiogenesis, Cell Adhesion, Cell Biology, Cell Motility/Cytoskeleton/Structure, Immunology, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules, Protein Kinases/Phosphatase
Antigen References

1. Taddei A, et al. 2008. Nat. Cell Biol. 10:923.
2. Gavard J, et al. 2006. Nat. Cell Biol. 8:1223.
3. Kim I, et al. 2005. Blood 106:903.
4. Suzuki S, et al. 1991. Cell Regul. 2:261.

Gene ID
1003 View all products for this Gene ID
UniProt
View information about CD144 on UniProt.org
Go To Top Version: 1    Revision Date: 10/15/2024

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account