TotalSeq™-D0821 anti-human CD164 Antibody

Pricing & Availability
Clone
67D2 (See other available formats)
Regulatory Status
RUO
Other Names
Sialomucin CD164, MUC-24, multi-glycosylated core protein 24, MGC-24
Isotype
Mouse IgG1, κ
Barcode Sequence
GAGGCACTTAACATA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
324815 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

The 67D2 monoclonal antibody recognizes human CD164 also known as sialomucin CD164, MUC-24, and multi-glycosylated core protein 24. CD164 is a single pass transmembrane protein with short cytoplasmic tail that is highly N- and O-glycosylated. This protein contains sialic acid and a Ser-Gly motif that may serve as an attachment for a glycosaminoglycan side chain. Three splice variants of CD164 have been reported with apparent molecular weights ranging between 80-100 kD. CD164 is expressed in bone marrow, bone marrow stromal cells, and CD34+ hematopoietic cells myeloid and erythroid progenitors; and activated basophils. Expression has also been reported on a variety of carcinomas and leukemic cells and in the small intestine, colon, lung, and thyroid. CD164 plays a role in cell adhesion and proliferation and acts as a negative signaling molecule for hematopoietic progenitor cells. CD164 has also been reported to be involved in myogenic differentiation and cancer metastasis. The 67D2 antibody has been shown to be useful for the flow cytometric detection of human CD164, Western blotting under non-reducing conditions (detects an 80-100 kD protein as well as a high molecular weight aggregate of approximately 220 kD), and immunofluorescence.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
T-47D breast carcinoma line
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting2,3 under non-reducing conditions (detects an 80-100 kD protein as well as a high molecular weight aggregate of approximately 220 kD), and immunofluorescence3.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Watt SM, et al. 1998. Blood 92:849.
  2. Watt SM, et al. 2000. Blood 95:3113.
  3. Doyonnas R, et al. 2000. J. Immunol. 165:840.
  4. Vogel W, et al. 2002. Haematologica 88:126.
RRID
AB_2936565 (BioLegend Cat. No. 324815)

Antigen Details

Structure
Single pass transmembrane protein with short cytoplasmic tail. Highly N- and O-glycosylated, contains sialic acid and a Ser-Gly motif that may serve as an attachment for a glycosaminoglycan side chain. Three splice variants have been reported with apparen
Distribution

Expressed in bone marrow, bone marrow stromal cells, and CD34+ hematopoietic cells myeloid and erythroid progenitors; activated basophils. Expressed on a variety of carcinomas and leukemic cells. Also expressed in the small intestine, colon, l

Function
Plays a role in cell adhesion and proliferation, negative signaling molecule for hematopoietic progenitor cells. Has also been reported to be involved in myogenic differentiation and cancer metastasis
Cell Type
Basophils, Hematopoietic stem and progenitors, Leukemia
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Zannettino ACW, et al. 1998. Blood 92:2613.
2. Havens AM, et al. 2006. BMC Cancer 6:195.
3. Lee YN, et al. 2001. Mol. Cell. Biol. 21:7696.

Gene ID
8763 View all products for this Gene ID
UniProt
View information about CD164 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 01/05/2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account