- Clone
- Tü39 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- MHC class II, Major Histocompatibility complex II, human leukocyte antigen, HLA
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- AGCTACGAGCAGTAG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
361719 | 10 µg | 296€ |
HLA-DR, HLA-DP, and HLA-DQ are heterodimeric cell surface glycoproteins comprised of an α (heavy) chain and a β (light) chain. They are expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In conjunction with the CD3/TCR complex and CD4 molecules, HLA-DR is critical for efficient peptide presentation to CD4+ T cells. Variations in the HLA gene expression are crucial to graft survival.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Baboon, Cynomolgus, Cat, Dog, Cow
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human PBL
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Tü39 has been reported to react with a shared epitope of HLA-DR, HLA-DP, and HLA-DQ.
Additional reported applications (of relevant formats) include immunoprecipitation6, in vitro blocking of MLR5, and suppressor cell generation4. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (contact our custom solutions team). - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Pawelec G, et al. 1985. Hum. Immunol. 12:165.
- Shaw S, et al. 1985. Hum. Immunol. 12:191.
- Ziegler A, et al. 1986. Immunobiology 171:77.
- Pawelec G, et al. 1986. Hum. Immunol. 17:343. (Block)
- Dai Z, et al. 2009. J. Exp. Med. 206:793. (Block)
- Pawelec G, et al. 1988. J. Exp. Med. 167:243. (IP)
- RRID
-
AB_2922573 (BioLegend Cat. No. 361719)
Antigen Details
- Structure
- Ig superfamily, MHC class II, heterodimeric transmembrane protein
- Distribution
-
B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs
- Function
- Antigen presentation
- Ligand/Receptor
- CD3/TCR, CD4
- Cell Type
- Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- MHC Antigens
- Antigen References
-
1. Thorsby E. 1974. Transplant. Rev. 18:51.
2. Qvigstad E, et al. 1984. Hum. Immunol. 11:207.
3. Servenius B, et al. 1984. EMBO J. 3:3209.
4. Ottenhoff TH, et al. 1985. Hum. Immunol. 13:105.
5. Strassmann G, et al. 1985. Hum. Immunol. 13:125.
6. Trowsdale J, et al. 1985. Immunol Rev. 85:5. - Gene ID
- 3122 View all products for this Gene ID 3123 View all products for this Gene ID 3113 View all products for this Gene ID 3115 View all products for this Gene ID 3117 View all products for this Gene ID 3119 View all products for this Gene ID
- UniProt
- View information about HLA-DR DP DQ on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All HLA-DR, DP, DQ Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human HLA-DR, DP, DQ | Tü39 | FC,IHC-P,IP |
FITC anti-human HLA-DR, DP, DQ | Tü39 | FC |
Alexa Fluor® 647 anti-human HLA-DR, DP, DQ | Tü39 | FC |
PE/Cyanine7 anti-human HLA-DR, DP, DQ | Tü39 | FC |
APC anti-human HLA-DR, DP, DQ | Tü39 | FC |
PerCP/Cyanine5.5 anti-human HLA-DR, DP, DQ | Tü39 | FC |
PE anti-human HLA-DR, DP, DQ | Tü39 | FC |
APC/Fire™ 750 anti-human HLA-DR, DP, DQ | Tü39 | FC |
TotalSeq™-A1018 anti-human HLA-DR, DP, DQ | Tü39 | PG |
TotalSeq™-D1018 anti-human HLA-DR, DP, DQ | Tü39 | PG |
TotalSeq™-B1018 anti-human HLA-DR, DP, DQ | Tü39 | PG |
Spark Blue™ 574 anti-human HLA-DR, DP, DQ | Tü39 | FC |
TotalSeq™-C1018 anti-human HLA-DR, DP, DQ | Tü39 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human HLA-DR, DP, DQ
-
FITC anti-human HLA-DR, DP, DQ
-
Alexa Fluor® 647 anti-human HLA-DR, DP, DQ
-
PE/Cyanine7 anti-human HLA-DR, DP, DQ
-
APC anti-human HLA-DR, DP, DQ
-
PerCP/Cyanine5.5 anti-human HLA-DR, DP, DQ
-
PE anti-human HLA-DR, DP, DQ
-
APC/Fire™ 750 anti-human HLA-DR, DP, DQ
-
TotalSeq™-A1018 anti-human HLA-DR, DP, DQ
-
TotalSeq™-D1018 anti-human HLA-DR, DP, DQ
-
TotalSeq™-B1018 anti-human HLA-DR, DP, DQ
-
Spark Blue™ 574 anti-human HLA-DR, DP, DQ
-
TotalSeq™-C1018 anti-human HLA-DR, DP, DQ
Follow Us