- Clone
- UP-H2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CD300e, CMRF35-A5, LMIR6
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTCAGTCAACCGTTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
339705 | 10 µg | 296€ |
IREM-2 (immune receptor expressed by myeloid cells 2), also known as CMRF35-A5, LMIR6, CD300Le or CD300e, is a 34 kD type I single transmembrane glycoprotein. It is a member of the CD300 family and of the Ig-superfamily. IREM-2 is expressed on monocyte and myeloid dendritic cells, but not on granulocytes and lymphoid dendritic cells. IREM-2 is an activating receptor through interaction with DAP12.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- IREM-IgG fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications include: immunoprecipitation and stimulation of TNF-a production by monocytes
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Aguilar H, et al. 2004. J. Immunol. 173:6703
- Gasiorowski RE, et al. 2013. Immunol Lett. 149:93. PubMed
- RRID
-
AB_2936672 (BioLegend Cat. No. 339705)
Antigen Details
- Structure
- 34 kD, type I transmembrane glycoprotein, CD300 family, Ig superfamily
- Distribution
-
Monocytes, macrophages, dendritic cells
- Function
- Activation of myeloid cells
- Cell Type
- Dendritic cells, Macrophages, Monocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Aguilar H, et al. 2004. J. Immunol. 173:6703
- Gene ID
- 342510 View all products for this Gene ID
- UniProt
- View information about CD300e on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD300e Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD300e (IREM-2, CMRF35-A5) | UP-H2 | FC |
TotalSeq™-D1279 anti-human CD300e (IREM-2, CMRF35-A5) | UP-H2 | PG |
Spark YG™ 581 anti-human CD300e (IREM-2, CMRF35-A5) | UP-H2 | FC |
PE/Cyanine7 anti-human CD300e (IREM-2, CMRF35-A5) | UP-H2 | FC |
APC anti-human CD300e (IREM-2, CMRF35-A5) | UP-H2 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us