IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0205 anti-human CD206 (MMR) Antibody

Pricing & Availability
Clone
15-2 (See other available formats)
Regulatory Status
RUO
Other Names
MMR (macrophage mannose receptor), MR (mannose receptor), CD206, MRC1
Isotype
Mouse IgG1, κ
Barcode Sequence
TCAGAACGTCTAACT
Ave. Rating
Submit a Review
Cat # Size Price Quantity Check Availability Save
321155 10 µg 287€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Macrophage mannose receptor (MMR) is a 162-175 kD type I membrane protein also known as CD206, MRC1, or mannose receptor (MR). It is a pattern recognition receptor (PRR) that belongs to C-type lectin superfamily. MMR is expressed on macrophages, dendritic cells, and hepatic or lymphatic endothelial cells, but not on monocytes. MMR recognizes a range of microbial carbohydrates bearing mannose, fucose, or N-acetyl glucosamine. MMR mediates endocytosis and phagocytosis, induces activation of macrophages and antigen presentation, plays an important role in host defense, and provides a link between innate and adaptive immunity.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Purified human mannose receptor
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 15-2 antibody blocks the interaction of MMR with its ligand, and inhibits mannose receptor-mediated degradation of t-PA by macrophages. Additional reported applications of this antibody (for the relevant formats) include: Western blotting1, blocking of ligand binding1,2, immunofluorescence3, and immunohistochemical staining of acetone-fixed frozen tissue sections1. The Utra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 321149 and 321150).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Noorman F, et al. 1997. J. Leukocyte Biol. 61:63. (WB, IHC, Block)
  2. Barrett-Bergshoeff M, et al. 1997. Thromb Haemost. 77:718. (Block)
  3. Kato M, et al. 2007. J. Immunol. 179:6052. (IF)
RRID
AB_2927868 (BioLegend Cat. No. 321155)

Antigen Details

Structure
Type I membrane protein, Pattern Recognition Receptor (PRR) family, C-type lectin superfamily, 162-175 kD
Distribution

Macrophages, dendritic cells, hepatic and lymphatic endothelial cells

Function
Pathogen binding, facilitate phagocytosis and endocytosis, macrophage activation and antigen presentation
Ligand/Receptor
Mannose, fucose, N-acetyl glucosamine
Cell Type
Dendritic cells, Endothelial cells, Macrophages
Biology Area
Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Mason D, et al. Eds. 2002. Leukocyte Typing VII. Oxford University Press. p303
2. Wileman TE, et al. 1986. P. Natl. Acad. Sci. USA 83:2501.
3. Apostolopoulos V and McKenzie IF. 2001. Curr. Mol. Med. 1:469.
4. Le Cabec V, et al. 2005. J. Leukocyte Biol. 77:934.
5. Barrett-Bergshoeff M, et al. 1997. Thromb. Haemostatis 77:718.

Gene ID
4360 View all products for this Gene ID
UniProt
View information about CD206 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD206 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD206 (MMR) 15-2 FC,WB,ICC,IHC-F
FITC anti-human CD206 (MMR) 15-2 FC
PE anti-human CD206 (MMR) 15-2 FC
PE/Cyanine5 anti-human CD206 (MMR) 15-2 FC
APC anti-human CD206 (MMR) 15-2 FC
Alexa Fluor® 488 anti-human CD206 (MMR) 15-2 FC
Alexa Fluor® 647 anti-human CD206 (MMR) 15-2 FC
Biotin anti-human CD206 (MMR) 15-2 FC
APC/Cyanine7 anti-human CD206 (MMR) 15-2 FC
PerCP/Cyanine5.5 anti-human CD206 (MMR) 15-2 FC
PE/Cyanine7 anti-human CD206 (MMR) 15-2 FC
Brilliant Violet 421™ anti-human CD206 (MMR) 15-2 FC
Purified anti-human CD206 (MMR) (Maxpar® Ready) 15-2 FC,CyTOF®
Alexa Fluor® 700 anti-human CD206 (MMR) 15-2 FC
PE/Dazzle™ 594 anti-human CD206 (MMR) 15-2 FC
APC/Fire™ 750 anti-human CD206 (MMR) 15-2 FC
Brilliant Violet 711™ anti-human CD206 (MMR) 15-2 FC
Brilliant Violet 510™ anti-human CD206 (MMR) 15-2 FC
Brilliant Violet 605™ anti-human CD206 (MMR) 15-2 FC
Brilliant Violet 785™ anti-human CD206 (MMR) 15-2 FC
TotalSeq™-A0205 anti-human CD206 (MMR) 15-2 PG
TotalSeq™-B0205 anti-human CD206 (MMR) 15-2 PG
TotalSeq™-C0205 anti-human CD206 (MMR) 15-2 PG
Ultra-LEAF™ Purified anti-human CD206 (MMR) 15-2 FC,WB,ICC,IHC-F
Pacific Blue™ anti-human CD206 (MMR) 15-2 FC
PE/Fire™ 700 anti-human CD206 (MMR) 15-2 FC
TotalSeq™-D0205 anti-human CD206 (MMR) 15-2 PG
Spark NIR™ 685 anti-human CD206 (MMR) 15-2 FC
Spark Red™ 718 anti-human CD206 (MMR) (Flexi-Fluor™) 15-2 FC
Brilliant Violet 650™ anti-human CD206 (MMR) 15-2 FC
Spark Blue™ 574 anti-human CD206 (MMR) (Flexi-Fluor™) 15-2 FC
Spark Blue™ 550 anti-human CD206 (MMR) (Flexi-Fluor™) 15-2 FC
Go To Top Version: 1    Revision Date: 09/20/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account