Loading...

TotalSeq™-D0066 anti-human CD7 Antibody

Pricing & Availability
Clone
CD7-6B7 (See other available formats)
Regulatory Status
RUO
Workshop
IV T-164
Other Names
gp40
Isotype
Mouse IgG2a, κ
Barcode Sequence
TGGATTCCCGGACTT
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Quantity Check Availability Save
343133 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD7 is a 40 kD type I transmembrane glycoprotein also known as gp40. It is a member of the immunoglobulin superfamily found on T cells, NK cells, thymocytes, hematopoietic progenitors, and monocytes (weakly). CD7 is also expressed on acute lymphocytic leukemia (ALL) and some acute myeloid leukemia (AML) cells. CD7 crosslinking induces a calcium flux in T lymphocytes, presumably as a result of cytoplasmic domain association with PI3-kinase. CD7 costimulation can induce cytokine secretion and modulate cellular adhesion.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
KG1a cell line
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported (for the relevant formats) applications include proteogenomics2.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Knapp W, et al. 1989. Leucocyte Typing IV:White Cell Differentiation Antigens. Oxford University Press.
  2. Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID
AB_2892413 (BioLegend Cat. No. 343133)

Antigen Details

Structure
Ig superfamily, type I transmembrane glycoprotein, 40 kD
Distribution

T cells, NK cells, thymocytes, hematopoietic progenitors, myeloid leukemic cell subsets

Function
T cell activation
Ligand/Receptor
Cytoplasmic domain associates with P13-kinase
Cell Type
Hematopoietic stem and progenitors, Leukemia, NK cells, T cells, Thymocytes
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Barclay N, et al. 1993. The Leucocyte Antigen FactsBook. Academic Press Inc. San Diego.
2. Stillwell R, et al. 2001. Immunol. Res. 24:31.
3. Rabinowich H, et al. 1994. J. Immunol. 152:517.

Gene ID
924 View all products for this Gene ID
UniProt
View information about CD7 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account