- Clone
- 9E2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- NKp46, NCR1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ACAATTTGAACAGCG
- Ave. Rating
- Submit a Review
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
331955 | 10 µg | 296€ |
CD335, also known as NKp46, is a member of the natural cytotoxicity receptor (NCR) family which triggers cytotoxicity in NK cells. CD335 is directly involved in target cell recognition and lysis, and is exclusively expressed on CD3-CD56+ NK cells, suggesting it is a universal marker for NK cells. NKp46, along with NKp30 and NKp44, is referred to as a natural cytoxicity receptor (NCR) and plays a very important role in killing virus-infected tumor cells and MHC-class I-unprotected cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- NKp46-Fc fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone 9E2 has been shown to block NK activation through NKp46.6
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
- RRID
-
AB_2936626 (BioLegend Cat. No. 331955)
Antigen Details
- Structure
- Type I membrane glycoprotein (46 kD)
- Distribution
-
Expressed on resting and activated NK cells
- Cell Type
- NK cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules
- Antigen References
-
1. Mandelboim O and Porgador A. 2001. Int. J. Biochem. Cell Biol. 33:1147.
2. Nakajima H, et al. 2000. Eur. J. Immunol. 30:3309.
3. Sivori S. 1999. Eur. J. Immunol. 29:1656. - Gene ID
- 9437 View all products for this Gene ID
- UniProt
- View information about CD335 on UniProt.org
Related FAQs
Other Formats
View All CD335 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD335 (NKp46)
Human peripheral blood lymphocytes stained with purified 9E2... -
Biotin anti-human CD335 (NKp46)
Human peripheral blood lymphocytes stained with 9E2 biotin, ... -
PE anti-human CD335 (NKp46)
Human peripheral blood lymphocytes stained with CD56 (HCD56)... -
Alexa Fluor® 647 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes stained with 9E2 Alexa fl... -
Pacific Blue™ anti-human CD335 (NKp46)
Human peripheral blood lymphocytes stained with 9E2 Pacific ... -
Brilliant Violet 421™ anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 AP... -
PerCP/Cyanine5.5 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 FI... -
APC anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 PE... -
PE/Cyanine7 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 FI... -
FITC anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 AP... -
Brilliant Violet 510™ anti-human CD335 (NKp46)
-
Brilliant Violet 605™ anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 AP... -
Brilliant Violet 650™ anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 FI... -
PE/Dazzle™ 594 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 AP... -
Alexa Fluor® 700 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 PE... -
Brilliant Violet 711™ anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 FI... -
APC/Fire™ 750 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 FI... -
Alexa Fluor® 488 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 AP... -
TotalSeq™-B0101 anti-human CD335 (NKp46)
-
TotalSeq™-C0101 anti-human CD335 (NKp46)
-
TotalSeq™-A0101 anti-human CD335 (NKp46)
-
Brilliant Violet 785™ anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with CD56 PE... -
Ultra-LEAF™ Purified anti-human CD335 (NKp46)
Human peripheral blood lymphocytes stained with purified 9E2... -
APC/Cyanine7 anti-human CD335 (NKp46) Antibody
Human peripheral blood lymphocytes were stained with CD56 (c... -
PE/Cyanine5 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 810 anti-human CD335 (NKp46)
Human peripheral blood lymphocytes stained with anti-human C... -
TotalSeq™-D0101 anti-human CD335 (NKp46)
-
PE/Cyanine7 anti-human CD335
Typical results from human peripheral blood lymphocytes stai... -
Spark Red™ 718 anti-human CD335 (NKp46) (Flexi-Fluor™)
-
GMP PE/Cyanine7 anti-human CD335 (NKp46)
Typical results from human peripheral blood lymphocytes stai... -
Spark Blue™ 574 anti-human CD335 (NKp46) (Flexi-Fluor™)
-
Spark Blue™ 550 anti-human CD335 (NKp46) (Flexi-Fluor™)
Follow Us