TotalSeq™-D0120 anti-mouse TCR β chain Antibody

Pricing & Availability
Clone
H57-597 (See other available formats)
Regulatory Status
RUO
Other Names
TCR-β chain, TCR-β, β-TCR
Isotype
Armenian Hamster IgG
Barcode Sequence
TCCTATGGGACTCAG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
109265 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

T cell receptor (TCR) is a heterodimer consisting of an α and a β chain (TCR α/β) or a γ and a δ chain (TCR γ/δ). TCR-β is a member of the immunoglobulin superfamily and a component of the CD3/TCR complex (along with TCR-α). It is expressed on α/β TCR-bearing T cells and thymocytes. The CD3/TCR complex plays a key role in antigen recognition, signal transduction, and T cell activation.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Armenian Hamster
Immunogen
Affinity purified TCR from mouse DO-11.10 cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

H57-597 is a hamster mAb directed to an epitope of the C region of TCR ß chain12. The H57-597 antibody does not cross-react with ?/d TCR-bearing T cells. Immobilized or soluble H57-597 antibody can activate a/ß TCR-bearing T cells. Additional reported applications (for the relevant formats) for this antibody include: immunoprecipitation2, in vitro stimulation2,3, in vivo depletion4-6, and immunohistochemical staining of acetone-fixed frozen sections7,8,9. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 109253-109258).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Gascoigne NJ. 1990. J. Biol. Chem. 265:9296.
  2. Kruisbeek A, et al. 1991. In Current Protocols in Immunology. pp. 3.12.1. (Costim IP)
  3. Davenport C, et al. 1995. J. Immunol. 155:3742. (Costim)
  4. Drobyski W, et al. 1996. Blood 87:5355. (Deplete)
  5. Kummer U, et al. 2001. Immunol. Lett. 75:153. (Deplete)
  6. van der Heyde HC, et al. 1995. J. Immunol. 154:3985. (Deplete)
  7. Tomita K, et al. 1999. Genes Dev. 13:1203. (IHC)
  8. Podd BS, et al. 2006. J. Immunol. 176:6532. (IHC)
  9. Ponomarev ED, et al. 2007. J. Immunol. 178:39. (IHC)
  10. Chappaz S, et al. 2007. Blood doi:10.1182/blood-2007-02-074245. (FC) PubMed
  11. Tsukumo S, et al. 2006. J.Immunol. 177:8365. (FC) PubMed
  12. Grégoire C, et al. 1991. Proc. Natl. Acad. Sci USA 88:8077.

Antigen Details

Structure
Ig superfamily, CD3/TCR complex with CD3 and TCR α subunit
Distribution

Majority of T cells and thymocytes (correlated to differentiation)

Function
Antigen recognition, T cell activation
Ligand/Receptor
Peptide bound-MHC class I and II
Antigen References

1. Davis MM, et al. 1998. Ann. Rev. Immunol. 16:523.
2. Huppa JB, et al. 2003. Nat. Immunol. 4:749.
3. Kubo R, et al. 1989. J. Immunol. 142:2736.

Gene ID
21577 View all products for this Gene ID
UniProt
View information about TCR beta chain on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All TCR β chain Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse TCR β chain H57-597 FC
Biotin anti-mouse TCR β chain H57-597 FC,IHC-F
FITC anti-mouse TCR β chain H57-597 FC,IHC-F
PE anti-mouse TCR β chain H57-597 FC
PE/Cyanine5 anti-mouse TCR β chain H57-597 FC
Purified anti-mouse TCR β chain H57-597 FC,CyTOF®,IHC-F,IP,Costim,Depletion
Alexa Fluor® 488 anti-mouse TCR β chain H57-597 FC,IHC-F
Alexa Fluor® 647 anti-mouse TCR β chain H57-597 FC,IHC-F
APC/Cyanine7 anti-mouse TCR β chain H57-597 FC
PE/Cyanine7 anti-mouse TCR β chain H57-597 FC
Alexa Fluor® 700 anti-mouse TCR β chain H57-597 FC
Pacific Blue™ anti-mouse TCR β chain H57-597 FC
Brilliant Violet 421™ anti-mouse TCR β chain H57-597 FC,IHC-F
PerCP/Cyanine5.5 anti-mouse TCR β chain H57-597 FC
Brilliant Violet 570™ anti-mouse TCR β chain H57-597 FC
Brilliant Violet 510™ anti-mouse TCR β chain H57-597 FC,IHC-F
Purified anti-mouse TCR β chain (Maxpar® Ready) H57-597 FC,CyTOF®
Alexa Fluor® 594 anti-mouse TCR β chain H57-597 FC,IHC-F
PE/Dazzle™ 594 anti-mouse TCR β chain H57-597 FC
Brilliant Violet 605™ anti-mouse TCR β chain H57-597 FC
Brilliant Violet 711™ anti-mouse TCR β chain H57-597 FC
APC/Fire™ 750 anti-mouse TCR β chain H57-597 FC
TotalSeq™-A0120 anti-mouse TCR β chain H57-597 PG
Brilliant Violet 785™ anti-mouse TCR β chain H57-597 FC
Brilliant Violet 650™ anti-mouse TCR β chain H57-597 FC
Ultra-LEAF™ Purified anti-mouse TCR β chain H57-597 FC,CyTOF®,IHC-F,IP,Costim,Depletion
TotalSeq™-C0120 anti-mouse TCR β chain H57-597 PG
TotalSeq™-B0120 anti-mouse TCR β chain H57-597 PG
Spark Red™ 718 anti-mouse TCR β chain (Flexi-Fluor™) H57-597 FC
Spark PLUS UV395™ anti-mouse TCR β chain H57-597 FC
TotalSeq™-D0120 anti-mouse TCR β chain H57-597 PG
Spark Blue™ 574 anti-mouse TCR β chain (Flexi-Fluor™) H57-597 FC
Spark Blue™ 550 anti-mouse TCR β chain (Flexi-Fluor™) H57-597 FC
Go To Top Version: 1    Revision Date: 09/12/2024

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account