- Clone
- CB3-1 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI CD79.1
- Other Names
- Igb, Igβ (Ig-beta), B29
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ATTCTTCAACCGAAG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
341421 | 10 µg | 296€ |
CD79 is a heterodimeric molecule comprised of an α-chain (CD79a) and β-chain (CD79b). A 37-39 kD type I integral membrane protein CD79b is non-covalently associated with CD79a and cell surface IgM to form the B-cell receptor (BCR) complex. CD79b is expressed on the surface of surface Ig (sIg)-positive B cells and in the cytoplasm of sIg-negative B cells. It is essential for signal transduction after surface Ig crosslinking.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Nakamura T, et al. 1992. P. Natl. Acad. Sci. USA 89:8522.
- Garcia Vela J, et al. 1999. Leukemia. 13:1501.
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Rossi EA, et al. 2014. PLoS One. 9:98315. PubMed
- RRID
-
AB_2922559 (BioLegend Cat. No. 341421)
Antigen Details
- Structure
- 37-39 kD type I integral membrane protein, associate with CD79a and cell surface IgM to form the B-cell receptor (BCR) complex, Ig superfamily.
- Distribution
-
B cells
- Function
- From BCR complex, signal transduction
- Cell Type
- B cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Zola H, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. A John Wiley & Sons Inc.
2. Dylke J, et al. 2007. Immunol. Lett. 112:47 - Gene ID
- 974 View all products for this Gene ID
- UniProt
- View information about CD79b on UniProt.org
Related FAQs
Other Formats
View All CD79b Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD79b (Igβ)
-
APC anti-human CD79b (Igβ)
-
PerCP/Cyanine5.5 anti-human CD79b (Igβ)
-
Alexa Fluor® 647 anti-human CD79b (Igβ)
-
PE/Cyanine7 anti-human CD79b (Igβ)
-
APC/Fire™ 750 anti-human CD79b (Igβ)
-
TotalSeq™-A0187 anti-human CD79b (Igβ)
-
TotalSeq™-C0187 anti-human CD79b (Igβ)
-
TotalSeq™-B0187 anti-human CD79b (Igβ)
-
TotalSeq™-D0187 anti-human CD79b (Igβ)
-
PE anti-human CD79b
-
APC anti-human CD79b
-
PerCP/Cyanine5.5 anti-human CD79b
-
Spark Violet™ 423 anti-human CD79b (Igβ)
-
GMP PE anti-human CD79b (Igβ)
-
GMP APC anti-human CD79b (Igβ)
-
Brilliant Violet 785™ anti-human CD79b (Igβ)
-
PE/Fire™ 700 anti-human CD79b (Igβ)
-
GMP PerCP/Cyanine5.5 anti-human CD79b (Igβ)
-
Spark YG™ 593 anti-human CD79b (Igβ)
-
Brilliant Violet 711™ anti-human CD79b (Igβ)
-
PE/Cyanine5 anti-human CD79b (Igβ)
-
Spark Blue™ 550 anti-human CD79b (Igβ)
-
Spark Blue™ 574 anti-human CD79b (Igβ)
-
APC/Fire™ 750 anti-human CD79b
Follow Us