- Clone
- HIP8 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- IV P38
- Other Names
- gpIIb, CD41a
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- ACGTTGTGGCCTTGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
303751 | 10 µg | 296€ |
CD41 is a 125/25 kD α subunit of the gpIIb/IIIa (CD41/CD61) complex. CD41 is a heterodimer composed of a heavy chain (gpIIbα) and light chain (gpIIbβ) linked by a single disulfide bond. It is a member of the integrin family primarily expressed on platelets and megakaryocytes. CD41 has been reported to be involved with platelet aggregation and platelet attachment to the ECM. CD41/CD61 complex acts as the receptor for fibrinogen, fibronectin, Von Willebrand factor, and thrombin.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Capuchin Monkey, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections and blocking of platelet aggregation2. The HIP8 antibody has been reported to block the activation of platelets by various stimuli, including collagen, and ADP.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
- McCarty OJT, et al. 2000. Blood 96:1789.
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Zhi L et al. 2013. PLoS One. 8:e79869. (IHC)
- RRID
-
AB_2922536 (BioLegend Cat. No. 303751)
Antigen Details
- Structure
- Integrin family, α subunit of CD41/CD61 (GPIIb-IIIa) complex, 125/22 kD
- Distribution
-
Platelets, megakaryocytes
- Function
- Platelet aggregation, platelet attachment to extracellular matrix
- Ligand/Receptor
- Fibrinogen, fibronectin, von Willebrand factor, thrombin
- Cell Type
- Megakaryocytes, Platelets
- Biology Area
- Cell Adhesion, Cell Biology, Immunology
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Denzin L, et al. 1996. J. Exp. Med. 184:2153.
2. Denzin L, et al. 1995. Cell 82:155.
3. Riberdy J, et al. 1994. J. Cell Biol. 125:1225. - Gene ID
- 3674 View all products for this Gene ID
- UniProt
- View information about CD41 on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All CD41 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD41
Human platelets stained with HIP8 PE -
FITC anti-human CD41
Human peripheral blood platelets stained with HIP8 FITC -
PE anti-human CD41
Human platelets stained with HIP8 PE -
PE/Cyanine5 anti-human CD41
Human peripheral blood platelets stained with HIP8 PE/Cyanin... -
Purified anti-human CD41
Human peripheral blood platelets stained with HIP8, followed... -
Pacific Blue™ anti-human CD41
Human peripheral blood platelets were stained with CD41 (cl... -
APC/Cyanine7 anti-human CD41
Human platelets were stained with CD41 (clone HIP8) APC/Cyan... -
PE/Cyanine7 anti-human CD41
Human platelets were stained with CD41 (clone HIP8) PE/Cyani... -
PerCP/Cyanine5.5 anti-human CD41
Human peripheral blood platelets were stained with CD41 (clo... -
Purified anti-human CD41 (Maxpar® Ready)
-
Alexa Fluor® 647 anti-human CD41
Human platelets were stained with CD41 (clone HIP8) Alexa Fl... -
Alexa Fluor® 700 anti-human CD41
Human platelets were stained with CD41 (clone HIP8) Alexa Fl... -
Alexa Fluor® 488 anti-human CD41
Human platelets were stained with CD41 (clone HIP8) Alexa Fl... -
Brilliant Violet 421™ anti-human CD41
Human peripheral blood platelets were stained with CD41 (clo... -
PE/Dazzle™ 594 anti-human CD41
Human peripheral blood platelets were stained with anti-huma... -
Brilliant Violet 510™ anti-human CD41
Human platelets were stained with CD41 (clone HIP8) Brillian... -
Biotin anti-human CD41
Human peripheral blood platelets were stained with biotinyla... -
TotalSeq™-A0353 anti-human CD41
-
TotalSeq™-C0353 anti-human CD41
-
Brilliant Violet 785™ anti-human CD41
Human peripheral blood platelets were stained with anti-huma... -
Brilliant Violet 605™ anti-human CD41
Human peripheral blood platelets were stained with anti-huma... -
Ultra-LEAF™ Purified anti-human CD41
Human peripheral blood platelets stained with Ultra-LEAF™ Pu... -
TotalSeq™-B0353 anti-human CD41 Antibody
-
APC/Fire™ 750 anti-human CD41 Antibody
Human platelets were stained with anti-human CD41 (clone HIP... -
TotalSeq™-D0353 anti-human CD41
-
APC anti-human CD41
Typical results from Human peripheral blood platelets staine... -
FITC anti-human CD41
Typical results from Human peripheral blood platelets staine... -
GMP APC anti-human CD41
Typical results from Human peripheral blood platelets staine... -
PE anti-human CD41
Typical results from Human peripheral blood platelets staine...
Follow Us