TotalSeq™-D0803 anti-human CD253 (TRAIL) Antibody

Pricing & Availability
Clone
RIK-2 (See other available formats)
Regulatory Status
RUO
Other Names
Apo-2 ligand, Apo-2L, TNFSF10, CD253
Isotype
Mouse IgG1, κ
Barcode Sequence
GCCATTCCTGCCTAA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
308223 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

TRAIL is a 30 kD protein known as TNF-related apoptosis inducing ligand, CD253, TNFSF10, or Apo-2L. It can be expressed as a cell surface (30 kD) and soluble ligand (19-20 kD) produced by megakaryocytes and platelets, monocytes, neutrophils, NK cells and activated T cells. This antigen is also expressed on tumor cells and transformed cell lines. TRAIL has been reported to induce apoptosis in tumor and transformed cell lines by a caspase-dependent process. This antibody is useful for flow cytometric staining and blocking studies.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human TRAIL-transfected mouse cell line
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: blocking1-4 of TRAIL-induced apoptosis and T cell mediated cytotoxicity. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 308214).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Kayagaki N, et al. 1999. J. Immunol. 162:2639. (Block)
  2. Uno K, et al. 2003. Blood 101:3658. (Block)
  3. Sato K, et al. 2005. J. Immunol. 174:4025. (Block)
  4. Denny MF, et al. 2007. Blood 110:2907. (Block)
  5. Kemter E, et al. 2011. Xenotransplantation. 19:40. PubMed

Antigen Details

Structure
TNF ligand superfamily member, approximately 30 kD
Distribution

Widespread, highest expression in spleen, lung, prostate; NK, monocytes, neutrophils, activated T cells

Function
Induces apoptosis in tumorigenic and transformed cell lines, involved in T cell mediated cytotoxicity, TRAIL ligand of cognate receptors induces NF-κB signaling in a variety of cell types
Ligand/Receptor
DR4 and DR5 cognate receptors, also binds to the decoy receptors DcR1 and DcR2
Cell Type
Monocytes, Neutrophils, NK cells, T cells
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Pitti RM, et al. 1996. J. Biol. Chem. 271:12687.
2. Mariani SM, et al. 1998. Eur. J. Immunol. 28:973.
3. Dorothee G, et al. 2002. J. Immunol. 169:809.
4. Crist SA, et al. 2004. Exp. Hematology 32:1073.

Gene ID
8743 View all products for this Gene ID
UniProt
View information about CD253 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 02/06/2025

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account