- Clone
- 5D12 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- KLRF1, killer cell lectin-like receptor subfamily F, member 1
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TATAGTTCCTCTGTG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
346713 | 10 µg | 296€ |
NKp80, also known as killer cell lectin-like receptor subfamily F, member 1 (KLRF1), is a type II transmembrane C-type lectin-like receptor. NKp80 is expressed on the cell surface of nearly all NK cells as a homodimer with approximately 80 kD molecular mass. It is also found on a subset of effector memory CD8 T cells and γ/δ T cells. NKp80 induces NK-cell mediated cytotoxicity and cytokine production through interaction with its ligand, AICL (activation-induced C-type lectin), which is selectively expressed on myeloid cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant ectodomain of human NKp80
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Welte S, et al. 2006. Nat. Immunol. 7:1334.
- Kuttruff S, et al. 2009. Blood 113:358.
- RRID
-
AB_2936570 (BioLegend Cat. No. 346713)
Antigen Details
- Structure
- Type II transmembrane c-type lectin-like receptor, homodimer, 80 kD
- Distribution
-
NK cells, subset of CD8 T and γ/δ T cells
- Ligand/Receptor
- AICL (activation-induced C-type letcin)
- Bioactivity
- induce NK cell-mediated cytolysis and cytokine release
- Cell Type
- NK cells, T cells
- Biology Area
- Costimulatory Molecules, Immunology, Innate Immunity
- Antigen References
-
1. Kuttruff S, et al. 2009. Blood 113:358
2. Vitale M, et al. 2001. Eur. J. Immunol. 31:233 - Gene ID
- 51348 View all products for this Gene ID
- UniProt
- View information about NKp80 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All NKp80 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human NKp80 | 5D12 | FC |
APC anti-human NKp80 | 5D12 | FC |
TotalSeq™-A0923 anti-human NKp80 | 5D12 | PG |
Ultra-LEAF™ Purified anti-human NKp80 | 5D12 | FC,IP,Block |
TotalSeq™-D0923 anti-human NKp80 | 5D12 | PG |
TotalSeq™-B0923 anti-human NKp80 | 5D12 | PG |
TotalSeq™-C0923 anti-human NKp80 | 5D12 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us