- Clone
- JM7A4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- IL-15Rα chain, IL-15R, IL-15Rα
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- CATATTCCGCCGTAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
330211 | 10 µg | 296€ |
IL-15 receptor α (IL-15Rα) is a cytokine receptor with the structural homology to IL-2Rα (CD25). Both α receptors contain a group of β sandwich protein called sushi domains. Similar to IL-2Rα, IL-15Rα is able to form a heterotrimer with their β chain (CD122) and common γ chain (γc, CD132). But unlike IL-2Rα subunit, IL-15Rα itself binds to IL-15 with equivalent high affinity compared with the heterotrimeric complex. IL-15Rα is expressed as soluble or transmembrane forms by variety cells, such as activated monocytes, dendritic cells, CD8+ memory T cells, NK or NKT cells. IL-15Rα by itself forms stable complexes with IL-15 on cell surface and presents IL-15 in trans to neighboring cells. IL-15, like IL-2, is a pleiotropic four-helix bundle cytokine and plays a key role in promoting T and B cell survival and proliferation, preferentially in memory CD8+ T cell proliferation, and NK/NKT cell development.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
- RRID
-
AB_2894597 (BioLegend Cat. No. 330211)
Antigen Details
- Distribution
-
Dendritic cells, activated monocytes, memory CD8 T cells and NK/NKT cells
- Function
- Support T and B cell proliferation and development, preferentially for memory CD8+ T cell proliferation, and NK/NKT cell development
- Ligand/Receptor
- IL-15 with high affinity
- Cell Type
- Dendritic cells, Monocytes, NK cells, NKT cells, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Giri JG, et al. 1995. EMBO J. 14:3654.
2. Giron-Michel J, et al. 2005. Blood 106:2302.
3. Lorenzen I, et al. 2005. J. Biol. Chem. 281:6642.
4. Sato N, et al. 2007. Proc. Natl. Acad. Sci. USA. 104:588. - Gene ID
- 3601 View all products for this Gene ID
- UniProt
- View information about CD215 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD215 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Biotin anti-human CD215 (IL-15Rα) | JM7A4 | FC |
PE anti-human CD215 (IL-15Rα) | JM7A4 | FC |
APC anti-human CD215 (IL-15Rα) | JM7A4 | FC |
TotalSeq™-D0947 anti-human CD215 (IL-15Rα) | JM7A4 | PG |
TotalSeq™-C0947 anti-human CD215 (IL-15Rα) | JM7A4 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Biotin anti-human CD215 (IL-15Rα)
IFN-γ + LPS-stimulated human peripheral blood monocytes stai... -
PE anti-human CD215 (IL-15Rα)
IFN-γ + LPS-stimulated human peripheral blood monocyte... -
APC anti-human CD215 (IL-15Rα)
IFN-γ and LPS-stimulated (24 hours) human peripheral blood m... -
TotalSeq™-D0947 anti-human CD215 (IL-15Rα)
-
TotalSeq™-C0947 anti-human CD215 (IL-15Rα)
Follow Us