- Clone
- VIM3b (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V BP030
- Other Names
- BL-KDD/F12
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TTAACCCGTCGATTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
336315 | 10 µg | 296€ |
CD97 is a seven-span transmembrane protein belonging to the secretin receptor superfamily, the G-protein-coupled receptor superfamily, and the EGF-TM7 family with molecular weights of 74 kD, 80 kD, and 86 kD. It is expressed on monocytes/macrophages, granulocytes, dendritic cells, and smooth muscle cells.The expression of CD97 on resting T- and B-lymphocytes is at low level, but is rapidly upregulated upon activation. CD97 binds to CD55 (decay-accelerating factor), chondroitin sulfate, integrin a5b1, and a3b1. CD97 has been shown to mediate cell adhesion and co-stimulation of T cell proliferation.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- KG1a (human myeloid cell line)
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone VIM3b bindswithin the first EGF domain of CD97.4 Additional reported applications include: western blot, immunoprecipitation.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Hamann J, et al. 1995. J. Immunol. 155:1942.
- Lawrence DW, et al. 2003. J. Exp. Med. 198:999.
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Wobus M, et al. 2004. Int. J. Cancer 112:815.
- RRID
-
AB_2936600 (BioLegend Cat. No. 336315)
Antigen Details
- Structure
- Seven-span transmembrane protein belonging to the secretin receptor superfamily, the G-protein-coupled receptor superfamily, and the EGF-TM7 family, 74 kD, 80 kD, 86 kD
- Distribution
-
Monocytes/macrophages, granulocytes, dendritic cells, low levels on T cells and B-lymphocytes and upregulated upon activation
- Function
- Co-stimulation, adhesion
- Ligand/Receptor
- CD55, chondroitin sulfate, integrin α5β1, integrin α3β1
- Cell Type
- Dendritic cells, Granulocytes, Macrophages, Monocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Capasso M, et al. 2006. J. Immunol. 177:1070
2. Wang T, et al. 2005. Blood 105:2836
3. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. A John Wiley & Sons Inc, Publication - Gene ID
- 976 View all products for this Gene ID
- UniProt
- View information about CD97 on UniProt.org
Other Formats
View All CD97 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-human CD97 | VIM3b | FC |
PE anti-human CD97 | VIM3b | FC |
TotalSeq™-D1373 anti-human CD97 | VIM3b | PG |
TotalSeq™-C1373 anti-human CD97 | VIM3b | PG |
TotalSeq™-A1373 anti-human CD97 | VIM3b | PG |
TotalSeq™-B1373 anti-human CD97 | VIM3b | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us