- Clone
- 2D3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CD275, ICOSL, B7H2, ICOS-L, B7RP-1, B7-RP1
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- GTGCATTCAACAGTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
B7-H2, a member of the B7 family and the immunoglobulin superfamily, is a 40 kD protein also known as B7RP-1, B7h, B7-H2, GL50 and ICOS Ligand. Human B7-H2 is expressed by B lymphocytes, activated monocytes/macrophages, and dendritic cells. B7-H2 binds to a CD28-like receptor, inducible costimulator molecule (ICOS, AILIM, CRP-1), which is expressed by activated T cells. The interaction of ICOS with B7-H2 plays an important role in the T cell costimulation pathway.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human B7H2-mIg fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Kurosawa S, et al. 2003. Am. J. Respir. Cell Mol. Biol. 28:563.
- RRID
-
AB_2936564 (BioLegend Cat. No. 309425)
Antigen Details
- Structure
- Ig superfamily, B7 family, 40 kD
- Distribution
-
B cells and dendritic cells
- Function
- Binds ICOS on antigen-activated T cells and mediates proliferation and cytokine production
- Ligand/Receptor
- ICOS
- Cell Type
- B cells, Dendritic cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
- Wang S, et al. 2002. J. Biol. Chem. 96:2808.
- Wong SC, et al. 2003. Blood 102:1831.
- Gene ID
- 23308 View all products for this Gene ID
- UniProt
- View information about CD275 on UniProt.org
Related FAQs
Other Formats
View All CD275 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
PE anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC |
Purified anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC,IP,ELISA |
Biotin anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC |
APC anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC |
PE/Cyanine7 anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC |
TotalSeq™-A0009 anti-human CD275 (B7-H2, ICOSL) | 2D3 | PG |
Alexa Fluor® 647 anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC |
PerCP/Cyanine5.5 anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC |
TotalSeq™-C0009 anti-human CD275 (B7-H2, ICOSL) | 2D3 | PG |
TotalSeq™-B0009 anti-human CD275 (B7-H2, ICOSL) | 2D3 | PG |
PE/Dazzle™ 594 anti-human CD275 (B7-H2, ICOSL) | 2D3 | FC |
TotalSeq™-D0009 anti-human CD275 (B7-H2, ICOSL) | 2D3 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human CD275 (B7-H2, ICOSL)
-
Purified anti-human CD275 (B7-H2, ICOSL)
-
Biotin anti-human CD275 (B7-H2, ICOSL)
-
APC anti-human CD275 (B7-H2, ICOSL)
-
PE/Cyanine7 anti-human CD275 (B7-H2, ICOSL)
-
TotalSeq™-A0009 anti-human CD275 (B7-H2, ICOSL)
-
Alexa Fluor® 647 anti-human CD275 (B7-H2, ICOSL)
-
PerCP/Cyanine5.5 anti-human CD275 (B7-H2, ICOSL)
-
TotalSeq™-C0009 anti-human CD275 (B7-H2, ICOSL)
-
TotalSeq™-B0009 anti-human CD275 (B7-H2, ICOSL)
-
PE/Dazzle™ 594 anti-human CD275 (B7-H2, ICOSL)
-
TotalSeq™-D0009 anti-human CD275 (B7-H2, ICOSL)
Follow Us