TotalSeq™-D0420 anti-human CD158 (KIR2DL1/S1/S3/S5) Antibody

Pricing & Availability
Clone
HP-MA4 (See other available formats)
Regulatory Status
RUO
Other Names
CD158a, CD158g, CD158h, KIR2DL1, KIR2DS1, KIR2DS3, KIR2DS5
Isotype
Mouse IgG2b, κ
Barcode Sequence
TATCAACCAACGCTT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Save
339523 10 µg ¥81,180
Description

CD158 molecules, also known as KIRs (killer cell immunoglobulin-like receptors), are a family of transmembrane proteins with either two (KIR2D) or three (KIR3D) Ig-like extracellular domains. Some KIRs with long cytoplasmic domains contain ITIMs and posses inhibitory functions and others with short cytoplasmic region lack ITIM and have activation functions. 14 polymorphic KIR genes have been reported in humans. CD158 is mainly expressed on a subset of NK cells and a small population of CD8+ T cells. HLA-C is the ligand of CD158a/h.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Baboon, Cynomolgus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human NK cell clone LB2
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

mAb HP-MA4 reacts with KIR2DL1 (CD158a), KIR2DS1 (CD158h), KIR2DS3, and KIR2DS5 (CD158g).

Additional reported applications include: inhibits NK cell mediated cytotoxicity and immunoprecipitation.

This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. De Miguel M and M. Lopez-Botet. 2002. Inmunologia. 21:187
  2. Goodridge JP, et al. 2013. J. Immunol. 191:3553. PubMed

Antigen Details

Structure
Contains two Ig-like extracellular domains, 58/50 kD
Distribution

Subset of NK cells and a small subset of CD8+ T cells

Function
Inhibits NK cell function, play a role in self-tolerance.
Ligand/Receptor
HLA-C
Cell Type
NK cells, T cells
Biology Area
Immunology, Inhibitory Molecules
Molecular Family
CD Molecules
Antigen References

1. Zola H, et al. eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. Wiely-Liss A John Wiley & Sons Inc, Publication

Gene ID
3802 View all products for this Gene ID 3810 View all products for this Gene ID 3808 View all products for this Gene ID 3806 View all products for this Gene ID
UniProt
View information about CD158 on UniProt.org
Go To Top Version: 1    Revision Date: 09/19/2024

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account