Loading...

TotalSeq™-D0010 anti-human CD276 (B7-H3) Antibody

Pricing & Availability
Clone
DCN.70 (See other available formats)
Regulatory Status
RUO
Other Names
B7RP2
Isotype
Mouse IgG1, κ
Barcode Sequence
GACTGGGAGGGTATT
Ave. Rating
Submit a Review
Product Citations
publications
Compare all formats
Cat # Size Price Save
331609 10 µg ¥81,180
Description

B7-H3 is a member of the B7 gene family. It has 88% amino acid sequence identity with mouse B7-H3. It is mostly expressed on professional APCs, including B cells, macrophages, and dendritic cells. Its expression on dendritic cells appears to be up-regulated by LPS. B7-H3 protein inhibits T cell activation and cytokine production. It was reported that monoclonal antibody against B7-H3 enhanced T cell proliferation in vitro and led to exacerbated EAE in vivo. Therefore, B7-H3 may be a negative regulator on T cell activation and function.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2892401 (BioLegend Cat. No. 331609)

Antigen Details

Structure
About 49.7 KD transmembrane protein characterized by extracellular IgV and IgC domains.
Distribution

B7-H3 is expressed on professional APCs, including B cells, dendritic cells, and macrophages. It is reported to express on a minor fraction of CD4+ and CD8+ cells.

Ligand/Receptor
The receptor has not been identified, but it seems to be expressed on activated T cells.
Bioactivity
B7-H3 is a negative regulator of T cell activation and IL-2 production.
Cell Type
Antigen-presenting cells, B cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Sun M, et al. 2002. J. Immunology. 168:6294
2. Xu J, et al. 2006. Cellular and Molecular Immunology. 3:235

Gene ID
80381 View all products for this Gene ID
UniProt
View information about CD276 on UniProt.org
Go To Top Version: 1    Revision Date: 05/25/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere
Login / Register
Remember me
Forgot your password? Reset password?
Create an Account