- Clone
- UCHT1 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- III 471
- Other Names
- T3, CD3ε
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTCATTGTAACTCCT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD3ε is a 20 kD chain of the CD3/T-cell receptor (TCR) complex which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T-cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T cells, NKT cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections4,6,7 and formalin-fixed paraffin-embedded sections11, immunoprecipitation1, activation of T cells2,3,5, Western blotting9, and spatial biology (IBEX)16,17. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 300413, 300414, and 300432). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 300437, 300438, 300465, 300466, 300473, 300474) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Salmeron A, et al. 1991. J. Immunol. 147:3047. (IP)
- Graves J, et al. 1991. J. Immunol. 146:2102. (Activ)
- Lafont V, et al. 2000. J. Biol. Chem. 275:19282. (Activ)
- Ryschich E, et al. 2003. Tissue Antigens 62:48. (IHC)
- Thompson AG, et al. 2004. J. Immunol. 173:1671. (Activ)
- Sakkas LI, et al. 1998. Clin. Diagn. Lab. Immun. 5:430. (IHC)
- Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
- Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
- Van Dongen JJM, et al. 1988. Blood 71:603. (WB)
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Pollard, K. et al. 1987. J. Histochem. Cytochem. 35:1329. (IHC)
- Luckashenak N, et al. 2013. J. Immunol. 190:27. PubMed
- Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed
- Li J, et al. 2015. Cancer Res. 75:508. PubMed
- Stoeckius M, et al. 2017. Nat. Methods. 14:865-868. (PG)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2892342 (BioLegend Cat. No. 300485)
Antigen Details
- Structure
- Ig superfamily, with the subunits of CD3γ, CD3δ, CD3ζ (CD247) and TCR (α/β or γ/δ) forms CD3/TCR complex, 20 kD
- Distribution
-
Mature T and NK T cells, thymocyte differentiation
- Function
- Antigen recognition, signal transduction, T cell activation
- Ligand/Receptor
- Peptide antigen bound to MHC
- Cell Type
- NKT cells, T cells, Thymocytes, Tregs
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules, TCRs
- Antigen References
-
1. Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego.
2. Beverly P, et al. 1981. Eur. J. Immunol. 11:329.
3. Lanier L, et al. 1986. J. Immunol. 137:2501-2507. - Gene ID
- 916 View all products for this Gene ID
- UniProt
- View information about CD3 on UniProt.org
Other Formats
View All CD3 Reagents Request Custom ConjugationCustomers Also Purchased
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 APC -
Biotin anti-human CD3
Human peripheral blood lymphocytes stained with biotinylated... -
FITC anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 FITC -
PE anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 PE Pre-lysed human blood leukocytes were stained with PE anti-h... -
PE/Cyanine5 anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 PE/Cya... -
Purified anti-human CD3
Human peripheral blood lymphocytes stained with purified UCH... Human frozen spleen tissue slices were fixed with 4% PFA for... -
Alexa Fluor® 647 anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 Alexa ... Human peripheral mononuclear cells were fixed with 2% parafo... Human frozen tonsil tissue slices were fixed with 4% PFA for... -
Alexa Fluor® 488 anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 Alexa ... Human peripheral blood mononuclear cells and neutrophil mixe... Human frozen tonsil tissue slices were fixed with 4% PFA for... -
Pacific Blue™ anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 Pacifi... -
PE/Cyanine7 anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 PE/Cya... -
Alexa Fluor® 700 anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 Alexa ... -
APC/Cyanine7 anti-human CD3
Human peripheral blood lymphocytes were stained with CD19 FI... -
PerCP anti-human CD3
Human peripheral blood lymphocytes stained with UCHT1 PerCP -
PerCP/Cyanine5.5 anti-human CD3
Human peripheral blood lymphocytes were stained with CD3 (cl... -
Brilliant Violet 421™ anti-human CD3
Human peripheral blood lymphocytes were stained with CD3 (cl... Human peripheral blood mononuclear cells were fixed with 2% ... Human frozen tonsil tissue slices were fixed with 4% PFA for... -
Brilliant Violet 570™ anti-human CD3
Human peripheral blood lymphocytes were stained with CD19 AP... -
Ultra-LEAF™ Purified anti-human CD3
Human peripheral blood lymphocytes stained with LEAF™ purifi... Human peripheral blood lymphocytes stained with LEAF™ purifi... Human peripheral blood mononuclear cells were stained with C... -
Purified anti-human CD3 (Maxpar® Ready)
Human PBMCs stained with 154Sm-anti-CD45 (HI30) and 170Er-an... -
Alexa Fluor® 594 anti-human CD3
Human peripheral blood mononuclear cells were fixed with 2% ... Human peripheral blood lymphocytes were stained with CD3 (cl... Confocal image of human lymph node sample acquired using the... Confocal image of human lymph node sample acquired using the... -
PE/Dazzle™ 594 anti-human CD3
Human peripheral blood lymphocytes were stained with CD3 (cl... -
Brilliant Violet 510™ anti-human CD3
Human peripheral blood lymphocytes were stained with CD3 (cl... -
Brilliant Violet 605™ anti-human CD3
Human peripheral blood lymphocytes stained with CD3 (clone U... -
Brilliant Violet 711™ anti-human CD3
Human peripheral blood lymphocytes were stained with CD3 (cl... -
Brilliant Violet 650™ anti-human CD3
Human peripheral blood lymphocytes were stained with CD3 (cl... -
APC/Fire™ 750 anti-human CD3
Human peripheral blood lymphocytes were stained with CD19 FI... -
Pacific Blue™ anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
Brilliant Violet 785™ anti-human CD3
Human peripheral blood lymphocytes were stained with CD19 PE... -
PE/Dazzle™ 594 anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-A0034 anti-human CD3
-
TotalSeq™-B0034 anti-human CD3
-
TotalSeq™-C0034 anti-human CD3
-
PE anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
PE/Cyanine7 anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
KIRAVIA Blue 520™ anti-human CD3
Human Peripheral blood lymphocytes were stained with CD19 AP... -
Spark Violet™ 538 anti-human CD3 Antibody
Human peripheral blood lymphocytes were stained with CD3 (cl... -
TotalSeq™-D0034 anti-human CD3
-
Spark Blue™ 574 anti-human CD3 Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP Pacific Blue™ anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
GMP PE anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
GMP PE/Dazzle™ 594 anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
Spark Violet™ 423 anti-human CD3
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PE/Cyanine7 anti-human CD3
Typical results from human peripheral blood lymphocytes stai... -
Spark Blue™ 515 anti-human CD3
Human peripheral blood cells were surface stained with anti-...
Follow Us