- Clone
- RPA-T4 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- IV T114
- Other Names
- T4
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- TGTTCCCGCTCAACT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD4, also known as T4, is a 55 kD single-chain type I transmembrane glycoprotein expressed on most thymocytes, a subset of T cells, and monocytes/macrophages. CD4, a member of the Ig superfamily, recognizes antigens associated with MHC class II molecules, and participates in cell-cell interactions, thymic differentiation, and signal transduction. CD4 acts as a primary receptor for HIV, binding to HIV gp120. CD4 has also been shown to interact with IL-16.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The RPA-T4 antibody binds to the D1 domain of CD4 (CDR1 and CDR3 epitopes) and can block HIV gp120 binding and inhibit syncytia formation. Additional reported applications (for the relevant formats) include: immunohistochemistry of acetone-fixed frozen sections3,4,5, blocking of T cell activation1,2, and spatial biology (IBEX)10,11. This clone was tested in-house and does not work on formalin fixed paraffin-embedded (FFPE) tissue. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 300569 - 300574).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York. (Activ)
- Moir S, et al. 1999. J. Virol. 73:7972. (Activ)
- Deng MC, et al. 1995. Circulation 91:1647. (IHC)
- Friedman T, et al. 1999. J. Immunol. 162:5256. (IHC)
- Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
- Lan RY, et al. 2006. Hepatology 43:729.
- Zenaro E, et al. 2009. J. Leukoc. Biol. 86:1393. (FC) PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Stoeckius M, et al. 2017. Nat. Methods. 14:865. (PG)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2892343 (BioLegend Cat. No. 300575)
Antigen Details
- Structure
- Ig superfamily, type I transmembrane glycoprotein, 55 kD
- Distribution
-
T cell subset, majority of thymocytes, monocytes/macrophages
- Function
- MHC class II co-receptor, lymphocyte adhesion, thymic differentiation, HIV receptor
- Ligand/Receptor
- MHC class II molecules, HIV gp120, IL-16
- Cell Type
- Dendritic cells, Macrophages, Monocytes, T cells, Thymocytes, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Center D, et al. 1996. Immunol. Today 17:476.
2. Gaubin M, et al. 1996. Eur. J. Clin. Chem. Clin. Biochem. 34:723. - Gene ID
- 920 View all products for this Gene ID
- UniProt
- View information about CD4 on UniProt.org
Related FAQs
- I am unable to see expression of T cell markers such as CD3 and CD4 post activation.
- TCR-CD3 complexes on the T-lymphocyte surface are rapidly downregulated upon activation with peptide-MHC complex, superantigen or cross-linking with anti-TCR or anti-CD3 antibodies. PMA/Ionomycin treatment has been shown to downregulate surface CD4 expression. Receptor downregulation is a common biological phenomenon and so make sure that your stimulation treatment is not causing it in your sample type.
Other Formats
View All CD4 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD4
-
Biotin anti-human CD4
-
FITC anti-human CD4
-
PE anti-human CD4
-
PE/Cyanine5 anti-human CD4
-
PE/Cyanine7 anti-human CD4
-
Purified anti-human CD4
-
APC/Cyanine7 anti-human CD4
-
Alexa Fluor® 488 anti-human CD4
-
Alexa Fluor® 647 anti-human CD4
-
Pacific Blue™ anti-human CD4
-
Brilliant Violet 421™ anti-human CD4
-
Alexa Fluor® 700 anti-human CD4
-
PerCP anti-human CD4
-
PerCP/Cyanine5.5 anti-human CD4
-
Brilliant Violet 570™ anti-human CD4
-
Brilliant Violet 650™ anti-human CD4
-
Purified anti-human CD4 (Maxpar® Ready)
-
Alexa Fluor® 594 anti-human CD4
-
Brilliant Violet 510™ anti-human CD4
-
PE/Dazzle™ 594 anti-human CD4
-
Brilliant Violet 785™ anti-human CD4
-
Brilliant Violet 605™ anti-human CD4
-
Brilliant Violet 711™ anti-human CD4
-
APC/Fire™ 750 anti-human CD4
-
CD4 Fluorophore Sampler Kit
-
CD4 Fluorophore Sampler Kit with Veri-Cells™ PBMC
-
TotalSeq™-A0072 anti-human CD4
-
TotalSeq™-B0072 anti-human CD4
-
TotalSeq™-C0072 anti-human CD4
-
Ultra-LEAF™ Purified anti-human CD4
-
TotalSeq™-D0072 anti-human CD4
Follow Us