- Clone
- FUN-2 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- VI B051
- Other Names
- FCR II, FcγRII
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- GCTTCCGAATTACCG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD32 is a 40 kD polymorphic transmembrane glycoprotein also known as FcγRII and FCRII. It is an immunoglobulin superfamily member expressed on monocytes/macrophages, granulocytes, platelets and B cells. There are at least 6 isoforms of CD32 resulting from alternative mRNA splicing. CD32 mediates phagocytosis and oxidative burst in granulocytes, as well as platelet aggregation and immunomodulation. The extracellular domain of CD32 binds to polymeric and aggregated IgG and immune complexes, while the intracellular domain has been reported to associate with SHP-1 (B1 isoform).
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining3 of acetone-fixed frozen tissue sections.
Clone FUN-2 recognizes both CD32A and CD32B. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2936569 (BioLegend Cat. No. 303235)
Antigen Details
- Structure
- Ig superfamily, polymorphic transmembrane glycoprotein, 40 kD
- Distribution
-
Monocytes, granulocytes, B cells, platelets
- Function
- Endocytosis, cytotoxicity, platelet aggregation, B cell function
- Ligand/Receptor
- Aggregated IgG, immune complex
- Cell Type
- B cells, Dendritic cells, Granulocytes, Monocytes, Platelets
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules, Fc Receptors
- Antigen References
-
1. Stuart S, et al. 1989. EMBO J. 8:3657.
2. Huang Y, et al. 1999. Scand. J. Immunol. 49:177.
3. Hisaka H, et al. 1999. Pathobiology 67:92. - Gene ID
- 2212 View all products for this Gene ID
- UniProt
- View information about CD32 on UniProt.org
Related FAQs
- Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?
-
Yes
Other Formats
View All CD32 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
APC anti-human CD32 | FUN-2 | FC |
FITC anti-human CD32 | FUN-2 | FC |
PE anti-human CD32 | FUN-2 | FC |
Purified anti-human CD32 | FUN-2 | FC,IHC-F |
Alexa Fluor® 647 anti-human CD32 | FUN-2 | FC |
PE/Cyanine7 anti-human CD32 | FUN-2 | FC |
PerCP/Cyanine5.5 anti-human CD32 | FUN-2 | FC |
PE/Dazzle™ 594 anti-human CD32 | FUN-2 | FC |
APC/Fire™ 750 anti-human CD32 | FUN-2 | FC |
TotalSeq™-A0142 anti-human CD32 | FUN-2 | PG |
TotalSeq™-C0142 anti-human CD32 | FUN-2 | PG |
TotalSeq™-B0142 anti-human CD32 | FUN-2 | PG |
APC/Cyanine7 anti-human CD32 | FUN-2 | FC |
Biotin anti-human CD32 | FUN-2 | FC |
Spark Violet™ 500 anti-human CD32 | FUN-2 | FC |
TotalSeq™-D0142 anti-human CD32 | FUN-2 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD32
-
FITC anti-human CD32
-
PE anti-human CD32
-
Purified anti-human CD32
-
Alexa Fluor® 647 anti-human CD32
-
PE/Cyanine7 anti-human CD32
-
PerCP/Cyanine5.5 anti-human CD32
-
PE/Dazzle™ 594 anti-human CD32
-
APC/Fire™ 750 anti-human CD32
-
TotalSeq™-A0142 anti-human CD32
-
TotalSeq™-C0142 anti-human CD32
-
TotalSeq™-B0142 anti-human CD32
-
APC/Cyanine7 anti-human CD32
-
Biotin anti-human CD32
-
Spark Violet™ 500 anti-human CD32
-
TotalSeq™-D0142 anti-human CD32
Follow Us