TotalSeq™-D0143 anti-human CD196 (CCR6) Antibody

Pricing & Availability
Clone
G034E3 (See other available formats)
Regulatory Status
RUO
Other Names
BN-1, CKR6, DCR2, CKRL3, DRY-6, GPR29, CKR-L3, CMKBR6, GPRCY4, STRL22, GPR-CY4
Isotype
Mouse IgG2b, κ
Barcode Sequence
GATCCCTTTGTCACT
Ave. Rating
Submit a Review
Cat # Size Price Save
353447 10 µg ¥81,180
Description

CCR6, also known as CD196, is a chemokine receptor that is expressed on immature dendritic cells, B lymphocytes, and memory T cells. CCR6 binds CCL20, although members of the β defensin family also bind CCR6 with a lower affinity. CCR6 positive cells, and its ligand CCL20, have been detected in numerous organs, especially the secondary lymphoid organ. CCL20 is selectively made by the follicle-associated epithelium (FAE) overlying Peyers Patches (PPs) and isolated lymphoid follicles (ILFs). CCL20 contributes to the recruitment of CCR6-expressing B cells to these structures. In humans, CCR6 can function to mediate arrest of T cells on dermal endothelial cells and is highly expressed on T cells resident in both normal and psoriatic skin. CCR6 and/or CCL20 have been implicated in the pathogenesis of rheumatoid arthritis and inflammatory bowel disease. Human T cells that are able to produce IL-17 express CCR6. It suggests that CCL20 and CCR6 have a role in inflammatory diseases by recruiting Th17 cells to target tissues.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
CCR6-transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

RRID
AB_2894571 (BioLegend Cat. No. 353447)

Antigen Details

Structure
Chemokine receptor, GPCR, seven transmembrane receptor
Distribution

Immature dendritic cells, B lymphocytes, memory T cells, Th17 cells

Function
Host defense, important for recruitment of B cells to secondary lymphoid organs, mediates arrest of T cells on dermal endothelial cells
Ligand/Receptor
CCL20 (MIP-3α)
Cell Type
B cells, Dendritic cells, T cells, Th17
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References

1. Zaballos A, et al. 1996. Biochem. Bioph. Res. Co. 227:846.
2. Yang D, et al. 1999. Science 286:525.
3. MacDonald KG, et al. 2007. Am. J. Pathol. 170:1229.
4. Homey B, et al. 2000. J. Immunol. 164:6621.
5. Hirota K, et al. 2007. J. Exp. Med. 204:2803.
6. Singh SP, et al. 2008. J. Immunol. 180:214.

Gene ID
1235 View all products for this Gene ID
UniProt
View information about CD196 on UniProt.org

Related FAQs

Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?

Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.

Other Formats

View All CD196 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD196 (CCR6) G034E3 FC
Alexa Fluor® 647 anti-human CD196 (CCR6) G034E3 FC
Brilliant Violet 421™ anti-human CD196 (CCR6) G034E3 FC
PerCP/Cyanine5.5 anti-human CD196 (CCR6) G034E3 FC
PE anti-human CD196 (CCR6) G034E3 FC
FITC anti-human CD196 (CCR6) G034E3 FC
Alexa Fluor® 488 anti-human CD196 (CCR6) G034E3 FC
APC anti-human CD196 (CCR6) G034E3 FC
PE/Cyanine7 anti-human CD196 (CCR6) G034E3 FC
Brilliant Violet 605™ anti-human CD196 (CCR6) G034E3 FC
Brilliant Violet 785™ anti-human CD196 (CCR6) G034E3 FC
Brilliant Violet 510™ anti-human CD196 (CCR6) G034E3 FC
Brilliant Violet 650™ anti-human CD196 (CCR6) G034E3 FC
Purified anti-human CD196 (CCR6) (Maxpar® Ready) G034E3 FC,CyTOF®
PE/Dazzle™ 594 anti-human CD196 (CCR6) G034E3 FC
APC/Cyanine7 anti-human CD196 (CCR6) G034E3 FC
Alexa Fluor® 700 anti-human CD196 (CCR6) G034E3 FC
Brilliant Violet 711™ anti-human CD196 (CCR6) G034E3 FC
TotalSeq™-A0143 anti-human CD196 (CCR6) G034E3 PG
Pacific Blue™ anti-human CD196 (CCR6) G034E3 FC
TotalSeq™-C0143 anti-human CD196 (CCR6) G034E3 PG
APC/Fire™ 750 anti-human CD196 (CCR6) G034E3 FC
TotalSeq™-B0143 anti-human CD196 (CCR6) G034E3 PG
TotalSeq™-D0143 anti-human CD196 (CCR6) G034E3 PG
PE/Fire™ 640 anti-human CD196 (CCR6) G034E3 FC
APC/Fire™ 810 anti-human CD196 (CCR6) G034E3 FC
Spark NIR™ 685 anti-human CD196 (CCR6) G034E3 FC
PE/Fire™ 700 anti-human CD196 (CCR6) G034E3 FC
PE/Cyanine5 anti-human CD196 (CCR6) G034E3 FC
Biotin anti-human CD196 (CCR6) G034E3 FC
PE/Fire™ 810 anti-human CD196 (CCR6) G034E3 FC
PE/Fire™ 744 anti-human CD196 (CCR6) G034E3 FC
PerCP/Fire™ 780 anti-human CD196 (CCR6) Antibody G034E3 FC
Spark PLUS UV395™ anti-human CD196 (CCR6) G034E3 FC
PerCP/Fire™ 806 anti-human CD196 (CCR6) G034E3 FC
Go To Top Version: 1    Revision Date: 08/12/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account