TotalSeq™-D0167 anti-human CD35 Antibody, CD35, E11

Clone: E11 (See other available formats)
Regulatory Status: RUO
Workshop: III 204
Other Names: C3b/C4b receptor, complement receptor type 1 (CR1)
Isotype: Mouse IgG1, κ
Barcode Sequence: ACTTCCGTCGATCTT
Ave. Rating: Submit a Review
Product Citations: publications

Cat #	Size	Price	Save
333417	10 µg	¥81,180

Description

CD35 is a type I single chain of glycoprotein, also known as C3b/C4b receptor, Complement Receptor type 1 or CR1. Four molecular weight allotypes (160kD, 190kD, 220kD, and 250kD) have been described. CD35 is expressed on granulocytes, monocytes, B cells, erythrocytes, and follicular dendritic cells, as well as subsets of NK and T cells. CD35 binds complement C3b, C4b, or iC3, and iC4, and plays important roles in both innate and adoptive immune response via mediating phagocytosis by granulocytes and monocytes. CD35 has also been reported to inhibit T-cell proliferation.

Product Details

Technical data sheet

Product Details

Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: spatial biology (IBEX)^4,5.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_3083183 (BioLegend Cat. No. 333417)

Antigen Details

Structure: Type I glycoprotein with four allotypes, 160kD, 190kD, 220kD, 250kD
Distribution: Granulocytes, monocytes, B cells, erythrocytes, follicular dendritic cells, subsets of NK and T cells
Function: Adhesion, mediate phagocytosis, inhibit T-cell proliferation
Ligand/Receptor: C3b, iC3, C4b, iC4
Cell Type: B cells, Dendritic cells, Erythrocytes, Granulocytes, Monocytes, NK cells, T cells
Biology Area: Cell Biology, Complement, Immunology, Neuroinflammation, Neuroscience
Molecular Family: CD Molecules
Antigen References: 1. Zola Heddy, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD markers. WILEY-LISS
2. Klickstein LB, et al. 1988. J. Exp. Med. 168:1699
Gene ID: 1378 View all products for this Gene ID
UniProt: View information about CD35 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD35 Reagents Request Custom Conjugation

Description	Clone	Applications
Purified anti-human CD35	E11	FC,IP,IHC
FITC anti-human CD35	E11	FC
PE anti-human CD35	E11	FC,SB
TotalSeq™-A0167 anti-human CD35	E11	PG
TotalSeq™-C0167 anti-human CD35	E11	PG
TotalSeq™-B0167 anti-human CD35	E11	PG
Biotin anti-human CD35	E11	FC
Brilliant Violet 421™ anti-human CD35	E11	FC
TotalSeq™-D0167 anti-human CD35	E11	PG
APC anti-human CD35	E11	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 08/14/2023

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.