- Clone
- ML5 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V CD24.5
- Other Names
- Ly-52, Heat Stable Antigen (HSA), Nectadrin, BA-1
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- AGATTCCTTCGTGTT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD24 is a 35-45 kD glycosylphosphatidylinositol (GPI)-linked protein also known as heat stable antigen (HSA), BA-1, Ly-52, and nectadrin. It is expressed on the surface of B cells (but not plasma cells), granulocytes, follicular dendritic cells, and epithelial cells. CD24 may play a role in the regulation of B-cell proliferation and maturation. CD24 crosslinking induces a Ca2+ flux in mature B cells. CD24 has been shown to interact with CD62P (P-selectin).
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Chimpanzee
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunofluorescence microscopy3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds. 1995. Leukocyte Typing V:White Cell Differentiation Antigens. Oxford University Press. New York.
- McMichael A, et al. 1987. Leucocyte Typing III. Oxford University Press. New York.
- Yang GP, et al. 1999. Nucleic Acids Research 27:1517. (IF)
- Kristiansen G, et al. 2003. Clin. Cancer Res. 9:4906. (FC)
- RRID
-
AB_2922544 (BioLegend Cat. No. 311149)
Antigen Details
- Structure
- GPI-linked glycoprotein, 35-45 kD
- Distribution
-
B cells, granulocytes, epithelial cells
- Function
- B cell proliferation and differentiation
- Ligand/Receptor
- CD62P (P-Selectin)
- Cell Type
- B cells, Epithelial cells, Granulocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Schlossman S, et al. Eds. 1995. Leukocyte Typing V. Oxford University Press. New York.
- Gene ID
- 100133941 View all products for this Gene ID
- UniProt
- View information about CD24 on UniProt.org
Related FAQs
Other Formats
View All CD24 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD24
-
PE anti-human CD24
-
Purified anti-human CD24
-
Alexa Fluor® 488 anti-human CD24
-
Alexa Fluor® 647 anti-human CD24
-
PerCP/Cyanine5.5 anti-human CD24
-
APC anti-human CD24
-
PE/Cyanine7 anti-human CD24
-
Brilliant Violet 421™ anti-human CD24
-
Brilliant Violet 605™ anti-human CD24
-
PerCP anti-human CD24
-
Brilliant Violet 510™ anti-human CD24
-
Purified anti-human CD24 (Maxpar® Ready)
-
Biotin anti-human CD24
-
APC/Cyanine7 anti-human CD24
-
PE/Dazzle™ 594 anti-human CD24
-
Brilliant Violet 711™ anti-human CD24
-
PE anti-human CD24
-
TotalSeq™-A0180 anti-human CD24
-
APC/Fire™ 750 anti-human CD24
-
Brilliant Violet 785™ anti-human CD24
-
TotalSeq™-C0180 anti-human CD24
-
TotalSeq™-B0180 anti-human CD24
-
PE/Cyanine5 anti-human CD24
-
TotalSeq™-D0180 anti-human CD24
-
GMP PE anti-human CD24
-
APC/Fire™ 750 anti-human CD24
-
Brilliant Violet 650™ anti-human CD24
-
PerCP/Cyanine5.5 anti-human CD24
-
Spark Blue™ 550 anti-human CD24 (Flexi-Fluor™)
-
Spark Red™ 718 anti-human CD24 (Flexi-Fluor™)
Follow Us