- Clone
- HA58 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- ICAM-1, Ly-47
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CTGATAGACTTGAGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD54 is a 85-110 kD type I transmembrane protein also known as ICAM-1. It is expressed on activated endothelial cells, high endothelial venules, T and B cells, monocytes/macrophages, granulocytes, and dendritic cells. The expression of ICAM-1 can be released from the cell surface. CD54 plays a role in cellular adhesion and is involved in inflammation and leukocyte extravasation. CD54 has also been shown to be the major cellular receptor for rhinovirus. ICAM-1 binds to CD11a/CD18 (LFA-1), CD11b/CD18 (Mac-1), CD11c/CD18 (p150, 95) as well as hyaluronan and fibrinogen.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Colonic cancer BM314 cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone HA58 recognizes an epitope located in the extracellular D1 domain of CD543. Additional reported applications (for the relevant formats) include: spatial biology (IBEX)4,5.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2894586 (BioLegend Cat. No. 353137)
Antigen Details
- Structure
- Type I membrane protein, Ig superfamily, 85-110 kD
- Distribution
-
Endothelial cells, T cells and B cells, monocytes/macrophages, granulocytes, and dendritic cells
- Cell Type
- B cells, Dendritic cells, Endothelial cells, Granulocytes, Macrophages, Mesenchymal Stem Cells, Monocytes, T cells
- Biology Area
- Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers, Stem Cells
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Voraberger G, et al. 1991. J. Immunol. 147:2777.
2. Staunton DE, et al. 1988. Cell 52:925.
3. Greve JM, et al. 1989. Cell 56:839. - Gene ID
- 3383 View all products for this Gene ID
- UniProt
- View information about CD54 on UniProt.org
Related FAQs
Other Formats
View All CD54 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD54 | HA58 | FC,ICC,IHC |
PE anti-human CD54 | HA58 | FC |
FITC anti-human CD54 | HA58 | FC |
Pacific Blue™ anti-human CD54 | HA58 | FC |
APC anti-human CD54 | HA58 | FC |
Alexa Fluor® 647 anti-human CD54 | HA58 | FC,SB |
PE/Dazzle™ 594 anti-human CD54 | HA58 | FC |
APC/Fire™ 750 anti-human CD54 | HA58 | FC |
PE/Cyanine7 anti-human CD54 | HA58 | FC |
PerCP/Cyanine5.5 anti-human CD54 | HA58 | FC |
TotalSeq™-A0217 anti-human CD54 | HA58 | PG |
Alexa Fluor® 700 anti-human CD54 | HA58 | FC |
TotalSeq™-C0217 anti-human CD54 | HA58 | PG |
Alexa Fluor® 488 anti-human CD54 | HA58 | FC |
Brilliant Violet 421™ anti-human CD54 | HA58 | FC |
Ultra-LEAF™ Purified anti-human CD54 | HA58 | FC,ICC,IHC-F |
TotalSeq™-B0217 anti-human CD54 | HA58 | PG |
TotalSeq™-D0217 anti-human CD54 | HA58 | PG |
Brilliant Violet 711™ anti-human CD54 | HA58 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD54
-
PE anti-human CD54
-
FITC anti-human CD54
-
Pacific Blue™ anti-human CD54
-
APC anti-human CD54
-
Alexa Fluor® 647 anti-human CD54
-
PE/Dazzle™ 594 anti-human CD54
-
APC/Fire™ 750 anti-human CD54
-
PE/Cyanine7 anti-human CD54
-
PerCP/Cyanine5.5 anti-human CD54
-
TotalSeq™-A0217 anti-human CD54
-
Alexa Fluor® 700 anti-human CD54
-
TotalSeq™-C0217 anti-human CD54
-
Alexa Fluor® 488 anti-human CD54
-
Brilliant Violet 421™ anti-human CD54
-
Ultra-LEAF™ Purified anti-human CD54
-
TotalSeq™-B0217 anti-human CD54
-
TotalSeq™-D0217 anti-human CD54
-
Brilliant Violet 711™ anti-human CD54
Follow Us