TotalSeq™-D0224 anti-human TCR α/β antibody, TCR α/β, IP26

Clone: IP26 (See other available formats)
Regulatory Status: RUO
Other Names: α/β TCR, TCR α/β
Isotype: Mouse IgG1, κ
Barcode Sequence: CGTAACGTAGAGCGA
Ave. Rating: Submit a Review
Product Citations: publications

Cat #	Size	Price	Save
306751	10 µg	¥81,180

Description

The IP26 antibody reacts with a monomorphic determinant of the α/β T-cell receptor, which is expressed on greater than 95% of normal peripheral blood CD3⁺ T cells. The α/β TCR recognizes a peptide bound to MHC leading to T-cell activation.

Product Details

Technical data sheet

Product Details

Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: T cell activation. When co-staining with anti-CD3, we recommend using clone UCHT1, since we have confirmed that IP26 does not compete with this clone. Other anti-CD3 clones may compete out the binding of IP26.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2892369 (BioLegend Cat. No. 306751)

Antigen Details

Structure: Ig superfamily, with CD3 forms CD3/TCR complex
Distribution: T cells, thymocytes
Function: Antigen recognition, T cell activation
Ligand/Receptor: Peptide bound to MHC
Cell Type: T cells, Thymocytes, Tregs
Biology Area: Adaptive Immunity, Immunology
Molecular Family: TCRs
Antigen References: 1. Marchalonis J, et al. 2002. J. Mol. Recognit. 15:260.
Gene ID: 6955 View all products for this Gene ID 6957 View all products for this Gene ID
UniProt: View information about TCR alpha/beta on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All TCR α/β Reagents Request Custom Conjugation

Description	Clone	Applications
Biotin anti-human TCR α/β	IP26	FC
FITC anti-human TCR α/β	IP26	FC
PE anti-human α/β T Cell Receptor	IP26	FC
PE/Cyanine5 anti-human TCR α/β	IP26	FC
Purified anti-human TCR α/β	IP26	FC
PE/Cyanine7 anti-human TCR α/β	IP26	FC
Alexa Fluor® 488 anti-human TCR α/β	IP26	FC
Alexa Fluor® 647 anti-human TCR α/β	IP26	FC
Pacific Blue™ anti-human TCR α/β	IP26	FC
APC anti-human TCR α/β	IP26	FC
Brilliant Violet 421™ anti-human TCR α/β	IP26	FC
PerCP/Cyanine5.5 anti-human TCR α/β	IP26	FC
PE/Dazzle™ 594 anti-human TCR α/β	IP26	FC
APC/Cyanine7 anti-human TCR α/β	IP26	FC
Alexa Fluor® 700 anti-human TCR α/β	IP26	FC
Brilliant Violet 510™ anti-human TCR α/β	IP26	FC
APC/Fire™ 750 anti-human TCR α/β	IP26	FC
Brilliant Violet 605™ anti-human TCR α/β	IP26	FC
TotalSeq™-A0224 anti-human TCR α/β	IP26	PG
Brilliant Violet 711™ anti-human TCR α/β	IP26	FC
Brilliant Violet 785™ anti-human TCR α/β	IP26	FC
TotalSeq™-C0224 anti-human TCR α/β	IP26	PG
Brilliant Violet 750™ anti-human TCR α/β	IP26	FC
TotalSeq™-B0224 anti-human TCR α/β	IP26	PG
PE anti-human TCR α/β	IP26	FC
APC/Fire™ 810 anti-human TCR α/β	IP26	FC
TotalSeq™-D0224 anti-human TCR α/β	IP26	PG
GMP PE anti-human TCR α/β	IP26	FC
Spark Red™ 718 anti-human TCR α/β (Flexi-Fluor™)	IP26	FC
Brilliant Violet 650™ anti-human TCR α/β	IP26	FC
FITC anti-human TCR α/β	IP26	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.