- Clone
- BV10A4H2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- FMS-like tyrosine kinase-3, FLT-3, STK-1, Flk-2
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CAGTAGATGGAGCAT
- Ave. Rating
- Submit a Review
CD135 is a 130-160 kD type III tyrosine kinase receptor expressed on CD34+ hematopoietic stem cells, myelomonocytic progenitors, primitive B cell progenitors, and thymocytes. CD135 is also expressed on malignant hematopoietic cells including AML, ALL and CML-BC. CD135, also known as FMS-like tyrosine kinase-3, FLT3, STK-1, and Flk-2, is a growth factor receptor that binds the FLT3 ligand to promote the growth and differentiation of primitive hematopoietic cells. The intracytoplasmic domain of CD135 is modified by phosphorylation and has been shown to interact with Grb2, SOCS1, VAV1, and Shc.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- BV-173 pro-B cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2922546 (BioLegend Cat. No. 313325)
Antigen Details
- Structure
- Member of the immunoglobulin supergene family, type 3 tyrosine kinase receptor; 130-160 kD
- Distribution
-
Expressed on CD34+ hematopoietic stem cells, myelomonocytic progenitors, primitive B cell progenitors, and thymocytes. Also expressed on AML, ALL and CML-BC tumor cells
- Function
- Tyrosine kinase growth factor receptor involved in the growth and differentiation of primitive hematopoietic cells
- Ligand/Receptor
- FLT3 ligand
- Cell Type
- B cells, Hematopoietic stem and progenitors, Leukemia, Thymocytes
- Biology Area
- Cell Biology, Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Rappold I, et al. 1997. Blood 90:111.
2. Rosnet O, et al. 1996. Acta Haematol. 95:218.
3. Rosnet O, et al. 1996. Leukemia 10:238.
4. Bertho JM, et al. 2000. Scand. J. Immunol. 52:53. - Gene ID
- 2322 View all products for this Gene ID
- UniProt
- View information about CD135 on UniProt.org
Related FAQs
Other Formats
View All CD135 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
PE anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
APC anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
PE/Cyanine5 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
Biotin anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
PE/Cyanine7 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
PerCP/Cyanine5.5 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
TotalSeq™-A0351 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | PG |
PE/Dazzle™ 594 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
TotalSeq™-B0351 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | PG |
TotalSeq™-C0351 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | PG |
TotalSeq™-D0351 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | PG |
Brilliant Violet 711™ anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
Brilliant Violet 650™ anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
Alexa Fluor® 647 anti-human CD135 (Flt-3/Flk-2) | BV10A4H2 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD135 (Flt-3/Flk-2)
Human pre-B leukemia cell line REH stained with purified BV1... -
PE anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH stained with BV10A4H2 PE -
APC anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH stained with BV10A4H2 APC -
PE/Cyanine5 anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH stained with BV10A4H2 PE/Cyanine5 -
Biotin anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH stained with biotinylated BV10A4H2... -
PE/Cyanine7 anti-human CD135 (Flt-3/Flk-2)
Human acute lymphoblastic leukemia cell line REH was stained... -
PerCP/Cyanine5.5 anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH was stained with CD135 (clone BV10... -
TotalSeq™-A0351 anti-human CD135 (Flt-3/Flk-2)
-
PE/Dazzle™ 594 anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH was stained with CD135 (Flt-3/Flk-... -
TotalSeq™-B0351 anti-human CD135 (Flt-3/Flk-2)
-
TotalSeq™-C0351 anti-human CD135 (Flt-3/Flk-2)
-
TotalSeq™-D0351 anti-human CD135 (Flt-3/Flk-2)
-
Brilliant Violet 711™ anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH was stained with anti-human CD135 ... -
Brilliant Violet 650™ anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH was stained with anti-human CD135 ... -
Alexa Fluor® 647 anti-human CD135 (Flt-3/Flk-2)
Human pre-B cell line REH was stained with anti-human CD135 ...
Follow Us