- Clone
- HB15e (See other available formats)
- Regulatory Status
- RUO
- Other Names
- HB15
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CCACTCATTTCCGGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD83 is a 43 kD single chain type I glycoprotein also known as HB15. A member of the immunoglobulin superfamily, CD83 is expressed on a subset of dendritic cells, Langerhans cells, and weakly on activated lymphocytes. Although CD83 is thought to play a role in antigen presentation and/or lymphocyte activation, the precise function of this protein is unknown. CD83 is considered to be a useful marker for mature dendritic cells.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Pigtailed Macaque, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections4.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press New York.
- Zhou L, et al. 1995. J. Immunol. 154:3821.
- Cao W, et al. 2005. Biochem. J. 385:85.
- Lore K, et al. 2002. AIDS 16:683. (IHC)
- Cho H, et al. 2007. Physiol Genomics doi:10.1152/physiolgenomics.00051.2006
- RRID
-
AB_2892362 (BioLegend Cat. No. 305345)
Antigen Details
- Structure
- Ig superfamily, single chain transmembrane glycoprotein, 43 kD
- Distribution
-
Dendritic cells, Langerhan cells, activated B and T cells
- Cell Type
- B cells, Dendritic cells, Langerhans cells, T cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Kozlow E, et al. 1993. Blood 81:454.
2. Zhou L, et al. 1992. J. Immunol. 149:735.
3. Zhou L, et al. 1995. Blood 86:3295. - Gene ID
- 9308 View all products for this Gene ID
- UniProt
- View information about CD83 on UniProt.org
Other Formats
View All CD83 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
APC anti-human CD83 | HB15e | FC |
Biotin anti-human CD83 | HB15e | FC |
FITC anti-human CD83 | HB15e | FC |
PE anti-human CD83 | HB15e | FC |
PE/Cyanine5 anti-human CD83 | HB15e | FC |
Purified anti-human CD83 | HB15e | FC,IHC-F |
Alexa Fluor® 488 anti-human CD83 | HB15e | FC |
Alexa Fluor® 647 anti-human CD83 | HB15e | FC |
PerCP/Cyanine5.5 anti-human CD83 | HB15e | FC |
Brilliant Violet 421™ anti-human CD83 | HB15e | FC |
PE/Cyanine7 anti-human CD83 | HB15e | FC |
PE/Dazzle™ 594 anti-human CD83 | HB15e | FC |
APC/Cyanine7 anti-human CD83 | HB15e | FC |
Brilliant Violet 711™ anti-human CD83 | HB15e | FC |
APC/Fire™ 750 anti-human CD83 | HB15e | FC |
Brilliant Violet 605™ anti-human CD83 | HB15e | FC |
Brilliant Violet 785™ anti-human CD83 | HB15e | FC |
TotalSeq™-A0359 anti-human CD83 | HB15e | PG |
TotalSeq™-C0359 anti-human CD83 | HB15e | PG |
TotalSeq™-B0359 anti-human CD83 | HB15e | PG |
TotalSeq™-D0359 anti-human CD83 | HB15e | PG |
Brilliant Violet 510™ anti-human CD83 | HB15e | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD83
-
Biotin anti-human CD83
-
FITC anti-human CD83
-
PE anti-human CD83
-
PE/Cyanine5 anti-human CD83
-
Purified anti-human CD83
-
Alexa Fluor® 488 anti-human CD83
-
Alexa Fluor® 647 anti-human CD83
-
PerCP/Cyanine5.5 anti-human CD83
-
Brilliant Violet 421™ anti-human CD83
-
PE/Cyanine7 anti-human CD83
-
PE/Dazzle™ 594 anti-human CD83
-
APC/Cyanine7 anti-human CD83
-
Brilliant Violet 711™ anti-human CD83
-
APC/Fire™ 750 anti-human CD83
-
Brilliant Violet 605™ anti-human CD83
-
Brilliant Violet 785™ anti-human CD83
-
TotalSeq™-A0359 anti-human CD83
-
TotalSeq™-C0359 anti-human CD83
-
TotalSeq™-B0359 anti-human CD83
-
TotalSeq™-D0359 anti-human CD83
-
Brilliant Violet 510™ anti-human CD83
Follow Us