- Clone
- M1310G05 (See other available formats)
- Regulatory Status
- RUO
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- CTGGAGCGATTAGAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
IgG Fc is a homodimer that is composed of the constant region of the two heavy chains that form the IgG molecule. The Fc fragment mediates opsonization, antibody dependent cellular cytotoxicity (ADCC), and complement activation through binding to Fc receptors such as CD16, CD32, CD64, and the complement factor C1.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Human Siglec-E-IgG Fc fusion protein.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone M1310G05 recognizes IgG in the membrane of memory B cells, has a stronger affinity for IgG1 and IgG3 than for IgG2 and IgG4, and does not cross react with IgD, IgE, or IgM.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2924607 (BioLegend Cat. No. 410735)
Antigen Details
- Structure
- Homodimer formed by the constant region of the IgG heavy chain.
- Ligand/Receptor
- CD16, CD32, and CD64.
- Cell Type
- B cells
- Biology Area
- Immunology
- Antigen References
-
1. Paul, WE. (2003). Fundamental Immunology. Philadelphia, PA: Lippincott, Williams, & Wilkins.
- Gene ID
- 3500 View all products for this Gene ID
- UniProt
- View information about IgG Fc on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All IgG Fc Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human IgG Fc | M1310G05 | FC,ELISA |
Brilliant Violet 421™ anti-human IgG Fc | M1310G05 | FC |
Alexa Fluor® 488 anti-human IgG Fc | M1310G05 | FC |
PE anti-human IgG Fc | M1310G05 | FC |
PerCP/Cyanine5.5 anti-human IgG Fc | M1310G05 | FC |
APC anti-human IgG Fc | M1310G05 | FC |
FITC anti-human IgG Fc | M1310G05 | FC |
Biotin anti-human IgG Fc | M1310G05 | FC |
Brilliant Violet 510™ anti-human IgG Fc | M1310G05 | FC |
Alexa Fluor® 647 anti-human IgG Fc | M1310G05 | FC |
PE/Cyanine7 anti-human IgG Fc | M1310G05 | FC |
APC/Fire™ 750 anti-human IgG Fc | M1310G05 | FC |
TotalSeq™-A0375 anti-human IgG Fc | M1310G05 | PG |
TotalSeq™-C0375 anti-human IgG Fc | M1310G05 | PG |
TotalSeq™-B0375 anti-human IgG Fc | M1310G05 | PG |
APC/Cyanine7 anti-human IgG Fc | M1310G05 | FC |
KIRAVIA Blue 520™ anti-human IgG Fc | M1310G05 | FC |
TotalSeq™-D0375 anti-human IgG Fc | M1310G05 | PG |
PE/Dazzle™ 594 anti-human IgG Fc | M1310G05 | FC |
Brilliant Violet 711™ anti-human IgG Fc | M1310G05 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human IgG Fc
-
Brilliant Violet 421™ anti-human IgG Fc
-
Alexa Fluor® 488 anti-human IgG Fc
-
PE anti-human IgG Fc
-
PerCP/Cyanine5.5 anti-human IgG Fc
-
APC anti-human IgG Fc
-
FITC anti-human IgG Fc
-
Biotin anti-human IgG Fc
-
Brilliant Violet 510™ anti-human IgG Fc
-
Alexa Fluor® 647 anti-human IgG Fc
-
PE/Cyanine7 anti-human IgG Fc
-
APC/Fire™ 750 anti-human IgG Fc
-
TotalSeq™-A0375 anti-human IgG Fc
-
TotalSeq™-C0375 anti-human IgG Fc
-
TotalSeq™-B0375 anti-human IgG Fc
-
APC/Cyanine7 anti-human IgG Fc
-
KIRAVIA Blue 520™ anti-human IgG Fc
-
TotalSeq™-D0375 anti-human IgG Fc
-
PE/Dazzle™ 594 anti-human IgG Fc
-
Brilliant Violet 711™ anti-human IgG Fc
Follow Us